--- emboss-6.1.0.orig/debian/emboss.manpages +++ emboss-6.1.0/debian/emboss.manpages @@ -0,0 +1,226 @@ +debian/manpages/splitsource.1e +debian/manpages/cons.1e +debian/manpages/seqretset.1e +debian/manpages/edialign.1e +debian/manpages/seqret.1e +debian/manpages/palindrome.1e +debian/manpages/fuzztran.1e +debian/manpages/histogramtest.1e +debian/manpages/pepwindowall.1e +debian/manpages/cutseq.1e +debian/manpages/acdpretty.1e +debian/manpages/antigenic.1e +debian/manpages/printsextract.1e +debian/manpages/nospace.1e +debian/manpages/demostringnew.1e +debian/manpages/codcopy.1e +debian/manpages/nthseqset.1e +debian/manpages/getorf.1e +debian/manpages/demotable.1e +debian/manpages/aligncopy.1e +debian/manpages/prosextract.1e +debian/manpages/noreturn.1e +debian/manpages/cusp.1e +debian/manpages/fuzzpro.1e +debian/manpages/patmatmotifs.1e +debian/manpages/wordfinder.1e +debian/manpages/corbatest.1e +debian/manpages/jaspscan.1e +debian/manpages/trimspace.1e +debian/manpages/matcher.1e +debian/manpages/whichdb.1e +debian/manpages/findkm.1e +debian/manpages/extractalign.1e +debian/manpages/primers.1e +debian/manpages/tmap.1e +debian/manpages/checktrans.1e +debian/manpages/embossdata.1e +debian/manpages/restrict.1e +debian/manpages/sirna.1e +debian/manpages/pepwheel.1e +debian/manpages/showfeat.1e +debian/manpages/pepnet.1e +debian/manpages/origunion.1e +debian/manpages/stssearch.1e +debian/manpages/cirdna.1e +debian/manpages/prettyplot.1e +debian/manpages/aaindexextract.1e +debian/manpages/pepwindow.1e +debian/manpages/ajbad.1e +debian/manpages/testplot.1e +debian/manpages/dbxreport.1e +debian/manpages/density.1e +debian/manpages/descseq.1e +debian/manpages/splitter.1e +debian/manpages/etandem.1e +debian/manpages/twofeat.1e +debian/manpages/pasteseq.1e +debian/manpages/oddcomp.1e +debian/manpages/showalign.1e +debian/manpages/entret.1e +debian/manpages/maskfeat.1e +debian/manpages/garnier.1e +debian/manpages/wordmatch.1e +debian/manpages/stretcher.1e +debian/manpages/water.1e +debian/manpages/dbxgcg.1e +debian/manpages/textsearch.1e +debian/manpages/preg.1e +debian/manpages/emma.1e +debian/manpages/seqrettype.1e +debian/manpages/sixpack.1e +debian/manpages/plotcon.1e +debian/manpages/sizeseq.1e +debian/manpages/tfscan.1e +debian/manpages/inforesidue.1e +debian/manpages/backtranseq.1e +debian/manpages/prophecy.1e +debian/manpages/mwfilter.1e +debian/manpages/intconv.1e +debian/manpages/iep.1e +debian/manpages/chips.1e +debian/manpages/skipredundant.1e +debian/manpages/acdlog.1e +debian/manpages/dbigcg.1e +debian/manpages/backtranambig.1e +debian/manpages/cpgplot.1e +debian/manpages/wobble.1e +debian/manpages/distmat.1e +debian/manpages/dreg.1e +debian/manpages/pepstats.1e +debian/manpages/acdvalid.1e +debian/manpages/showpep.1e +debian/manpages/rebaseextract.1e +debian/manpages/coderet.1e +debian/manpages/dbxstat.1e +debian/manpages/plotorf.1e +debian/manpages/seqretallfeat.1e +debian/manpages/seqretsplit.1e +debian/manpages/prima.1e +debian/manpages/treetypedisplay.1e +debian/manpages/profit.1e +debian/manpages/showseq.1e +debian/manpages/degapseq.1e +debian/manpages/dbxfasta.1e +debian/manpages/freak.1e +debian/manpages/eprimer3.1e +debian/manpages/patmattest.1e +debian/manpages/patmatdb.1e +debian/manpages/infobase.1e +debian/manpages/merger.1e +debian/manpages/wordcount.1e +debian/manpages/listor.1e +debian/manpages/notseq.1e +debian/manpages/demosequence.1e +debian/manpages/infoseq.1e +debian/manpages/sigcleave.1e +debian/manpages/nohtml.1e +debian/manpages/seqretsingle.1e +debian/manpages/prophet.1e +debian/manpages/pepcoil.1e +debian/manpages/cpgreport.1e +debian/manpages/syco.1e +debian/manpages/maskambignuc.1e +debian/manpages/btwisted.1e +debian/manpages/silent.1e +debian/manpages/mwcontam.1e +debian/manpages/diffseq.1e +debian/manpages/pepinfo.1e +debian/manpages/redata.1e +debian/manpages/maskambigprot.1e +debian/manpages/primersearch.1e +debian/manpages/infoalign.1e +debian/manpages/emowse.1e +debian/manpages/needle.1e +debian/manpages/dbxflat.1e +debian/manpages/compseq.1e +debian/manpages/acdtrace.1e +debian/manpages/megamerger.1e +debian/manpages/msbar.1e +debian/manpages/newcpgseek.1e +debian/manpages/ajfeatest.1e +debian/manpages/epestfind.1e +debian/manpages/demofeatures.1e +debian/manpages/dottup.1e +debian/manpages/newcoils.1e +debian/manpages/tfextract.1e +debian/manpages/dbiflat.1e +debian/manpages/einverted.1e +debian/manpages/demoreport.1e +debian/manpages/dbifasta.1e +debian/manpages/dan.1e +debian/manpages/union.1e +debian/manpages/tranalign.1e +debian/manpages/seqmatchall.1e +debian/manpages/origsplitter.1e +debian/manpages/makeprotseq.1e +debian/manpages/trimseq.1e +debian/manpages/demoalign.1e +debian/manpages/dotmatcher.1e +debian/manpages/octanol.1e +debian/manpages/showorf.1e +debian/manpages/cutgextract.1e +debian/manpages/complex.1e +debian/manpages/trimest.1e +debian/manpages/tfm.1e +debian/manpages/dbiblast.1e +debian/manpages/revseq.1e +debian/manpages/makenucseq.1e +debian/manpages/biosed.1e +debian/manpages/yank.1e +debian/manpages/extractseq.1e +debian/manpages/abiview.1e +debian/manpages/est2genome.1e +debian/manpages/giep.1e +debian/manpages/acdc.1e +debian/manpages/polydot.1e +debian/manpages/transeq.1e +debian/manpages/featreport.1e +debian/manpages/vectorstrip.1e +debian/manpages/pscan.1e +debian/manpages/psiphi.1e +debian/manpages/embossversion.1e +debian/manpages/maskseq.1e +debian/manpages/prettyseq.1e +debian/manpages/newseq.1e +debian/manpages/banana.1e +debian/manpages/entrails.1e +debian/manpages/recoder.1e +debian/manpages/consambig.1e +debian/manpages/aligncopypair.1e +debian/manpages/wossname.1e +debian/manpages/featcopy.1e +debian/manpages/chaos.1e +debian/manpages/acdtable.1e +debian/manpages/charge.1e +debian/manpages/extractfeat.1e +debian/manpages/hmoment.1e +debian/manpages/remap.1e +debian/manpages/isochore.1e +debian/manpages/digest.1e +debian/manpages/equicktandem.1e +debian/manpages/lindna.1e +debian/manpages/helixturnhelix.1e +debian/manpages/codcmp.1e +debian/manpages/geecee.1e +debian/manpages/seqinfo.1e +debian/manpages/showdb.1e +debian/manpages/ajtest.1e +debian/manpages/seqretall.1e +debian/manpages/demolist.1e +debian/manpages/jaspextract.1e +debian/manpages/tcode.1e +debian/manpages/seealso.1e +debian/manpages/shuffleseq.1e +debian/manpages/supermatcher.1e +debian/manpages/dotpath.1e +debian/manpages/marscan.1e +debian/manpages/fuzznuc.1e +debian/manpages/skipseq.1e +debian/manpages/seqretsetall.1e +debian/manpages/demostring.1e +debian/manpages/notab.1e +debian/manpages/newcpgreport.1e +debian/manpages/cai.1e +debian/manpages/restover.1e +debian/manpages/nthseq.1e --- emboss-6.1.0.orig/debian/watch +++ emboss-6.1.0/debian/watch @@ -0,0 +1,2 @@ +version=3 +ftp://emboss.open-bio.org/pub/EMBOSS/EMBOSS-([\d.]*)\.tar\.gz --- emboss-6.1.0.orig/debian/rules +++ emboss-6.1.0/debian/rules @@ -0,0 +1,173 @@ +#!/usr/bin/make -f + +#export DH_VERBOSE=1 + +VERSION := $(shell dpkg-parsechangelog | grep Ver | cut -d' ' -f2 | cut -d- -f1) +RENAMED := cons pscan + +EMBOSS-TMP = $(CURDIR)/debian/emboss_tmp +EMBOSS = $(CURDIR)/debian/emboss +EMBOSS-TEST = $(CURDIR)/debian/emboss-test +AJAX = $(CURDIR)/debian/libajax6 +NUCLEUS = $(CURDIR)/debian/libnucleus6 + +CONFFLAGS = --prefix=/usr --bindir=/usr/lib/emboss + +# If openjdk-6-jdk is not installed don't tell configure to use it. +# This allows binary-arch builds to be performed without openjdk +# installed. +ifneq ($(wildcard /usr/lib/jvm/java-6-openjdk/include/classfile_constants.h),) + CONFFLAGS += --with-java=/usr/lib/jvm/java-6-openjdk/include + CONFFLAGS += --with-javaos=/usr/lib/jvm/java-6-openjdk/include/linux +endif + +config.status: + dh_testdir + ln -sf /usr/share/misc/config.sub . + ln -sf /usr/share/misc/config.guess . + ./configure $(CONFFLAGS) + +include /usr/share/quilt/quilt.make + +build: config.status patch debian/copyright build-stamp +build-stamp: + dh_testdir + $(MAKE) AJAX_FIXED_ROOT=\\\"/usr/share/EMBOSS\\\" + touch build-stamp + +# In order to use this rule you must install libemboss-acd-perl, xsltproc, docbook-xml and docbook-xsl +manpages: debian/manpages/success +debian/manpages/success: + debian/build-manpages.sh + echo "The manpages have been sucessfully built" > debian/manpages/success + +debian/copyright: + cat debian/copyright.introduction > $@ + cat "AUTHORS" >> $@ + cat "THANKS" >> $@ + +clean: unpatch + dh_testdir + dh_testroot + [ ! -f Makefile ] || $(MAKE) distclean + + find jemboss/ -type f -name "*.class" | xargs -r rm -f + + rm --force --recursive debian/emboss_tmp + + $(RM) config.status install-stamp + + # Temporary fix that may become unecessary in the future. + rm -f test/gb/Makefile test/wormpep/Makefile + + -cp debian/testembossrcbackup test/.embossrc + + dh_clean debian/copyright config.sub config.guess test-stamp + +install: build install-stamp +install-stamp: + dh_testdir + dh_testroot + dh_prep + dh_installdirs + + ### Binaries and data go to a temporary dir before being moved to their own package ### + $(MAKE) -C emboss install DESTDIR=$(EMBOSS-TMP) + + # Make symbolic links from /usr/bin to /usr/lib/emboss + cd $(EMBOSS)/usr/bin/ ; \ + for i in $(EMBOSS-TMP)/usr/lib/emboss/* ; \ + do ln -sf ../lib/emboss/`basename $$i` . ; \ + done + + ### Renaming conflicting binaries (see also in binary-arch) ### + for i in $(RENAMED) ; \ + do mv $(EMBOSS)/usr/bin/$$i $(EMBOSS)/usr/bin/em_$$i ; \ + done + + ### Ajax library: lib and libdevel packages. ### + $(MAKE) -C ajax install DESTDIR=$(AJAX) +# rm $(AJAX)/usr/include/pcre* # Not very elegant way to solve the conflict with libpcre-dev + mv $(AJAX)/usr/include $(AJAX)-dev/usr/include/ajax + mv $(AJAX)/usr/lib/*a $(AJAX)/usr/lib/*so $(AJAX)-dev/usr/lib + # Libtool .la libraries are not wanted anymore in Debian, see http://lists.debian.org/debian-devel/2009/08/msg00783.html + find $(AJAX)-dev/usr/lib -name '*.la' -exec rm {} \; + + ### Nuleus library: lib and libdevel packages. ### + $(MAKE) -C nucleus install DESTDIR=$(NUCLEUS) + mv $(NUCLEUS)/usr/include $(NUCLEUS)-dev/usr/include/nucleus + mv $(NUCLEUS)/usr/lib/*a $(NUCLEUS)/usr/lib/*so $(NUCLEUS)-dev/usr/lib + # Libtool .la libraries are not wanted anymore in Debian, see http://lists.debian.org/debian-devel/2009/08/msg00783.html + find $(NUCLEUS)-dev/usr/lib -name '*.la' -exec rm {} \; + + ### eplplot goes in emboss-lib, but lets'hope building on plplot some day. ### + $(MAKE) -C plplot install DESTDIR=$(CURDIR)/debian/emboss-lib + + ### Documentation goes in emboss-doc. ### + $(MAKE) -C doc install DESTDIR=$(CURDIR)/debian/emboss-doc + antiword $(CURDIR)/debian/emboss-doc/usr/share/EMBOSS/doc/manuals/domainatrix.doc > $(CURDIR)/debian/emboss-doc/usr/share/EMBOSS/doc/manuals/domainatrix.txt + # Remove this file when the relicenced file becomes part of the upstream tarball. + uudecode -o $(CURDIR)/debian/emboss-doc/usr/share/EMBOSS/doc/manuals/EMBOSS_qg.pdf $(CURDIR)/debian/EMBOSS_qg_new.pdf.uu + # Remove this file, that belongs to the PHYLIPNEW EMBASSY package (embassy-phylip in Debian). + # See EMBOSS bug ‘https://sourceforge.net/support/tracker.php?aid=2831977’. + rm $(CURDIR)/debian/emboss-doc/usr/share/EMBOSS/doc/programs/text/frestdist.txt + + $(MAKE) -C jemboss install DESTDIR=$(CURDIR)/debian/jemboss bindir=/usr/bin + # dangling LICEN[CS]E FILE + rm $(CURDIR)/debian/jemboss/usr/share/EMBOSS/jemboss/LICENSE + + ### Installation of the test suite + cp -a test $(CURDIR)/debian/emboss-test/usr/share/EMBOSS/ + sed -i "/SET emboss_tempdata/cSET emboss_tempdata /usr/share/EMBOSS/test" $(CURDIR)/debian/emboss-test/usr/share/EMBOSS/test/.embossrc + sed -i "/SET emboss_qadata/cSET emboss_qadata /usr/share/EMBOSS/test" $(CURDIR)/debian/emboss-test/usr/share/EMBOSS/test/.embossrc + mv $(CURDIR)/debian/emboss-test/usr/share/EMBOSS/test/.embossrc $(CURDIR)/debian/emboss-test/etc/emboss/embossrc.d/emboss-test + + dh_makeshlibs # Should it be invoked now ? + + touch install-stamp + +test: build test-stamp +test-stamp: +ifeq (,$(filter nocheck,$(DEB_BUILD_OPTIONS))) + $(RM) test-stamp + [ debian/testembossrcbackup ] || cp test/.embossrc debian/testembossrcbackup + sed -i "/SET emboss_tempdata/cSET emboss_tempdata $(CURDIR)/test" test/.embossrc + sed -i "/SET emboss_qadata/cSET emboss_qadata $(CURDIR)/test" test/.embossrc + echo "SET emboss_acdroot $(CURDIR)/emboss/acd" >> test/.embossrc + echo "SET emboss_data $(CURDIR)/emboss/data" >> test/.embossrc + echo "SET emboss_docroot $(CURDIR)/doc" >> test/.embossrc + cd test/qa && EMBOSSRC=$(CURDIR)/test PATH=$(CURDIR)/emboss:$$PATH ./qatest.csh + touch test-stamp +endif + +binary-indep: build install + dh binary-indep + +binary-arch: build install test + dh_testdir -a + dh_testroot -a + dh_installchangelogs -a ChangeLog + dh_installdocs -a +# dh_installmenu -a +# dh_desktop -a +# dh_installmime -a + dh_install -a + + # Install the manpages and provide a symlink for the renamed binaries. + dh_installman -a -p emboss + for i in $(RENAMED) ; \ + do dh_link usr/share/man/man1/$$i.1e.gz usr/share/man/man1/em_$$i.1e.gz ; \ + done + + dh_strip -a + dh_compress -a + dh_fixperms -a + dh_makeshlibs -a + dh_installdeb -a + dh_shlibdeps -a + dh_gencontrol -a + dh_md5sums -a + dh_builddeb -a -- -Z bzip2 + +binary: binary-indep binary-arch +.PHONY: build clean binary-indep binary-arch binary --- emboss-6.1.0.orig/debian/upstream-metadata.yaml +++ emboss-6.1.0/debian/upstream-metadata.yaml @@ -0,0 +1,17 @@ +DOI: 10.1016/S0168-9525(00)02024-2 +Contact: EMBOSS core development team +Homepage: http://emboss.sourceforge.net +Name: EMBOSS +PubMed: 10827456 +Reference_title: EMBOSS: The European Molecular Biology Open Software Suite +Reference_journal = Trends in Genetics +Reference_volume = 16 +Reference_number = 6 +Reference_pages = 276 - 277 +Reference_year = 2000 +Reference_issn = 0168-9525 +Reference_url = http://www.sciencedirect.com/science/article/B6TCY-40CRS27-G/2/b4e5945c07c58d5a1257cbd685971317 +Reference_author = Peter Rice and Ian Longden and Alan Bleasby +Watch: | + version=3 + ftp://emboss.open-bio.org/pub/EMBOSS/EMBOSS-([\d.]*)\.tar\.gz --- emboss-6.1.0.orig/debian/EMBOSS_qg_new.pdf.uu +++ emboss-6.1.0/debian/EMBOSS_qg_new.pdf.uu @@ -0,0 +1,2718 @@ +begin 644 EMBOSS_qg_new.pdf +M)5!$1BTQ+C0-)>+CS],-"C(P(#`@;V)J(#P\+TQI;F5A"A[UU>#45,AV0N<&U1>J#=,)OQ/L,/MABHE?P,C*?N`6DF +M(+8&8F$&QIM`^Q@8@?@U0(`!`-,V)#(-96YD%LP(#`@-3DU+C(R(#@T,ETO4&%R96YT(#$W(#`@4B]#;VYT96YT'1= +M+T5X=$=3=&%T93P\+T=3,2`R-R`P(%(^/CX^#65N9&]B:@TR-"`P(&]B:CP\ +M+U-U8G1Y<&4O5')U951Y<&4O1F]N=$1E7!E+T9O;G0^/@UE;F1O +M8FH-,C4@,"!O8FH\/"]3=6)T>7!E+U1R=654>7!E+T9O;G1$97-C'1'4W1A=&4O4T$@ +M9F%LT",W#<[_K\]U]K@[S +MU?7VZO-V:U2NMONK3&T*K^!_IEQ1IK9255ZD7FV?KC[?S%ZU,[S@O[D=KS99 +MFF49/+9`MWV]2FZ_7'^]OU=Z^P,9Y75:`UOZ"^R`3VE6=DCK*J0E-J9"#M^2 +MWW5>IGFB_C[W>N-2E[2Z2.OD49=IF2B]R0V\WH7'G=[8M$@ZI;]O_T*955J! +MRO@G4[:NT^J=P-SE0:#):Q9XJWUJDS-(*9/3]*PWID".&I!#1P=W">M/&`H:Z!I$Q]TJ.2=J44]'`_R/DFY.JK +MKD'0,VG4,:^1+DH[F]Q/>PUBJV0!/JE)7H$[HD3I0L+(NLB`,&C::V/@*I01 +M47R7I\861FW_P&B&D,9@IB;W_)AF-G.(\2WY$\+BT$"?S-I@*!8TMDZF$U[K +MY(VY0X+9F&`7U`7]>Q1SPJ,WP"O"C(A`[^`UI0@$I=<'FOP +M8@X"J_4L*S@_!40T.@/$HQ"L?)R%220%GN`S)U,0]1S(V\?PZ_!!J5M=(*,[73B0?*,+&WZK8Y`ZA_"Q +M?8'K"4Z0/8DN+W+VFC)@UVG28<=FH4?6E&^47 +MV.(P><`VX,!9G%&&AO<,I)%2Z'+!@1),5+@>*1LM&EN1`:3_$]2V`])&YP`\ +M/1*2PT(T6.D+YA.4P-`U3+83+GV0?%#M)+`GG>?$$@Z(XJGM&V$SH'>@QF81 +M_A,+Q%/Y^Z#02)ZR.:Q?]A2^@>HXX@(^32#-CF<;Q0C\A;YF=J5Y1JI +MUY`);?LH/P[$!$*$_4!!Q-$#-]JAU^XT,DPUM)2:?`:=RY7\@%0K&MZH^G<8 +MZ\COI=/!!8X#1RH^/^F*RXK-8.C"=JA7UD'TFS7EDFI$PTO7V#K6L?7LFA:3 +MK"!)6,[#H*E#-0\"F+0-[=*C"$1>^H`^:NPGBI'VVE$.'2Y))DV-],S'L]"! +MDHZ:)?GX5><9=SX4O1Q#:QF)D2!!N5GJ\18+_5H7'HZ1V7:+&"L*"GC'AS#H +M^`UIF +M*`/JU!9@;&LX@*M.1>@TFXUY*] +M>!&NS3!`?[$TW819OS`&]]V>#`+7LD$3&S1@:+!\1SD/EU)/V"LL)AB3,,H\ +MTU2!X#\(9(@.^75K@.2U14A>Z0$X=HUP9`UE_O"5&J/A/DFI!)<3+4B4843Z +M<";D(KQ3JRJI(/%LL12*1&X[G?$I*]TF6:J>`_]@H.PWQ^8E*">0!\&,GS7$5459O#3US/X@[$%$<+R\G1*BYOWO97'+2D'A.Q'./A5`'9H+;LJ"&CQW.CC)(AZV5%VS2 +M4S`5M?0ZX/S$9:_D^14)1[ZU+$*`[^6R9@W.#](4N.*W@3#_G\%9E!?U,4_[ +M!;=`VFL\<385SP]#^PT63ZII#?_O&7$QB%WXXMMB@=0)CUQ0QUU^V2"4+,#/ +M-)ELY'H;AI<0G(E\D%DH@VK'@UG)#!WE&BKIPY0/WU(\A][+H"6A"],S3-Q; +M5AUVQP(V1]@+OO)><(_P`@Z/SE*R'Q#/(L[7'T'5B\F_D!)5$A>%[^I?`08` +MS/S,A@UE;F1S=')E86T-96YD;V)J#3(Y(#`@;V)J/#PO3&5N9W1H(#$W,SN2(N4KU:N\(LR +MS_I+YD*U\'G+2\RSP=V%2#>=[C\K?79QH5S4^9,+M.O=7;&D=:25%I!F)V%- +M^=[14N40C-V9+DE_UQW!_)*USV!H:2U)I\D]VL'&W24V\PA%V2,X(.V$^P<[ +MAA>?W%V,.6S.VF&7N;_6%JE8!`[5'7TFC=2QWYS9RD:C4.;GWH6"C.Y(!#FR +MU\L3.<^.D,J&O+L3]T1)0S%('+5_7"J)AL+4,+L>#L*WU0W.,FC2N_;X(AZP +MS6271R0*WHJ6A0MAIO37T:4ENT;^1R$7(=/V[3AYE>(DZVH(F[S3 +M)9LDJ@CC=$N.]M?R.$HM/)N%VI?1LK)H--;$FT0KVS_(^P6\G]=,JBV3)'>8 +M&)FTU5O.P<;D8.F^$#=*]'Q^Q/HB')9O'OD6$&5O^1:0;T'SS7.^/6V$)TRR +MC`?&("-)YO9O^[IZHU(O9%Q`&HHCXPEZ3C-]+/0BCS+IN/7G!#^@>I[3/EI. +M!^\UT@\=QX:B@O7,KR7.0R4'[K4+GB/\R#(;BBW'<8/+GB\;NZE=T3J'2QT$,LUJ9,A0O8$"PP'S9"M^?3)>4Y_ +M67S^-("^AV_F(P%@5=/Y0N/[_7H=,@KI'I$6T)9(%[7`]U)C_+9WOA9T#6I= +M9(^&BR6P7`X,JD7^,(F.*AJUDYJI'X1*Q:ZY[7D*/+50CD>JB)\SA;LJW[QS +ML2"OWKB2P>&]*Q/1K5S)\5YQJZ7P;97MY/CN/,&_B&J=X#NCAR<+;3WV6[UH +MQ_Z$LT&-,*R_6(MAJ?W(89]9J"_97Z:7%9YCKV00WNDR0,$%W#M31-WA2;\' +MEQI:=E_$X6Q`;UDJL@]BT&3(O`E\71J_N/I:$H,E38O<.B*W/@!]$P"2_-TB +M-=_"=O2I;6?)?NFRC[F*4R4?>-*I\K?JPD>'_&R/)O,D>?V9,*M&7HKC\P*C +MH.QA8V?%L3V!Q-KL"_:6V3,1DMFO:2CA/C`/3:RL/Z92(_-)[*"LV?5,7^=[ +MK-M6XMU(Q7A!0EW9#NX+@W88>7!CYOFA)N]&W9[%M&IBW7#U,JA]0Z;V#JR9 +M'>PYWI&140D/..\X";RVP\3X+.V0;Z0=*HG:O^#:O)D3>&;5%(DUVM?Z((!; +M*0SQE/>&G[#D$;8@<2M.\887!M*WTD*HYYS;,SX[\;VPIMJ>39X5!;D0=`I@ +M$0P2C/*O*\FZ\VNS-5>6U80$,2Y`$&9 +M7RLM%/;34])R)T@)HDGVF(W=V@,79Q%`ZX[5'U6P13SRNI3B'H<,$6Q:!3;4J*$\+)<&?!4%)R'BV0 +MI^YN1\=!50GC14`H3@+.XF*:[C>@?X(I(\[MGARK2OQP,%UVZZDQF(^=C9$, +M+L4\,*)WY!$T39%IS>$.[T$@)(]Z.VT`CYIKRTIH6>]Y%O+D2,7FD\`H[8(, +M]@T9,'T\.$&W>R+@]'I'QTN"+L]>T)Q049FM7%T+@A51:]6VM"I`3B*?J#4'0\`8@-F&_JL(]AJP+X%.EL'F'6; +M>,7WG6.8R![_!]XO'/GK=+!5QI:?D7L4CC,Z"$LOVV"%]O;&N.%+[EWV +MC(/>Z%7JS^L/\S935J7%M#+\VCO*.R[JV$@:`4?*N0^C_K@<]+)S%36<%8]A +M@32ED`\/=I,8RT4@3>*IQE](/HR.LL6;%NX%5/Q1,.D/5S/O[[ID(G!T5=)1 +M(?M7@`$`217>A`UE;F1S=')E86T-96YD;V)J#3,P(#`@;V)J/#PO4W5B='EP +M92]47!E+T9O;G0^/@UE;F1O8FH-,S$@,"!O8FH\/"], +M96YG=&@@,3DR,2]&:6QT97(O1FQA=&5$96-O9&4^/G-T(-CNWO?C-:5P4`8(4M?)0)'U82VM)K:R5=4G@OR\/R5E) +MCEL8\&AF..3A&0[)G7ZX*HLRAK9T65G8)GB;V6P_VUQ95[0AMEF93=]#Q@:? +M36=7-/U^]25_.)B)=X7+MV82?>'SPDRJ,M^;B6OSCOXWM+:AL:)QP:/+^QT= +MLH6%L/<0L[0[4^G"..P=5?@?5?PV&3K>CRLDV.:WQAB<<[.?J2Q>G/L!S* +M.%JNO5B^04RT^1J.KMJQL%)!<+L3-,-" +M?W1PH"76$`)[3`BJ+JI(#X0M(:3+G^-?+]LJO:(GPF^A)@,;4R9Y%LT.S#__ +M5)'[49_,=Z:NA,F:CD/P0>PFJ*22+C40OG2$E2[9%",1\I0R%Q)ESEFA;(:0 +M;4B395<]XE>'3K;(<".8,61KB1=R+<"IOL#<,@4TT!/%X^Q,Q$6J\J4>!<,X +M-!!61,C"((AU48^H[6S9[;'`C/-&MM_VHDZUK@3(@XXS%1,]9Z3:Z,#N5_RK[F))'GHS06+Y:HSS9_=^X*SIB3B@X+Q)ZT$P>@VW?C_;K53P7@5[%=S_ +MER8&7L%0'+WEYQ@='=L>5>P`-\F_;C//AJ.:_6%7;6Q/*.',3GSIQ-(CI7P\ +MO/[2!75\1^6#D@77!PS9#8FWM+&^H.DBB)&L-8BMOGM6VI*3*"?TANC$%O8% +MB^?8(B0-X0$!XH"5WP2!?<\0'8Q:(I[`W(LJ"3Q4+2M!1^%`M*805(MS/23Q +M,B0=KT!C0P,O/$J]$6CGMN>&:9'7IO?4TFM[@\1/.KJUK.@PR*GOIAY%N00K +M<^6+VF=KYI!^E:X6"G%/D6M;$/,-5V:-^2CI$'RBO&7I#BJ4A`<6WJC42QTG(=E^J6VK\R6+I\.SCDTK1*G"JTN-/7`_"/!N +MUN\YUJDPGE-S*FC!CCDR-$ZXF1I?%A6G:B"CK%PS.3S=Z&H'",TXQ1.]E7-4 +M>AHT%2:B$*'T<&OA48%B+6G1(V86^D-5X4H0%V]0R=SX9O^FWH*,0\G^@-]I +MXR!=TK.V4Q2U49]I>NM1,@*&_1ECR..CS8:"H$>?YKAW@,R?R&%-\E_]WB'+ +M482JHF1UK_K[I,\CJL8'#%ZM5&YT#V4C#'>B"9)=3AJ8N-STA)HO\0]/DR.W/\JV` +M)#K!W5-*12<_Z*O%4R"FI,I&](*GLT]''C8S_!=M&L8W\_FN1\E#H%#AHX#) +MJ!ZSYL^&OT3NJ,30"93<\I7F\B(?L`N2$)`K0Y6QRK? +MZC976%0ITKA2C70D@L)GUIS@;'BV2/K']#&B$'UI8ZW'$HX9&^H2=-Y;G61J +M-I!42S5\X4'WTH>>&M:G8Z)SDPSU%WFC;)LQ;]B4-]!Z!#:(0C_GJM)RCP+/ +M/5NHT#=/G.:`B&O?(*>HS&ZOQ3IZK#V0?AKX,VL(\&NJC,!C!_C4].:'(NG].B +MPUUV]VBC;?I2:61[7"(U3?Z$TLAIO9)J&:2,5=)46V[>>-ATC\@-X_SUMW/6 +M9C32$??$&8&K4LT])1!;Q(IZD3(="-I#<_5`\XA>\)X_Y8"]KI*C`!J=B*"1 +MO):^G#]L9Y)`?3X[R.I+G!,U^Z+R5WYL+/6AWYK*4?;[B(]6^CPU5:"!"GCD +MCU0?N(Y75KH9_=*0Z-GPW0S\GZX+A=!*)^K1S:S7S[R5?>.AEU46?!:*N?]! +MJS>H)EZ=ZV8J%'SL@"\?AL#C/-T1;VY4S4$!/CSKPBKM+)).O&K%3^36=/@) +M+4M#H9%NO6:-/)N)?ETDBK-_!1@`)_CS.PUE;F1S=')E86T-96YD;V)J#3,R +M(#`@;V)J/#PO3&5N9W1H(#$X,#$O1FEL=&5R+T9L871E1&5C;V1E/CYS=')E +M86T-"DB)G%?);N-&$/T"_P,O`=B!Q;#9"\DY#F8."68PAU$.P2`'FI)L)38E +M:XEA!/GW5+TJ-FG90`:YB.JMJOK5JZ67OUS]M%S&S&;+S=7RQZNR*+UOLV5_ +M56;+IZMO^69G%E55U/GAP2QLI#^=3ISHVQ0Q/QKZU'EF?E]"F!=AKJC+JLY( +MS`>6:NL`J4595HV([OA@FY^-ST^LQ>6L(A2!5BPML((VW^*WQPRK#H7-[S$G +MO\]T/+LYX_S)8#D3:7W?'7&@42$T'4I:'[#\MC!>R63#&CK78N4*4[@K;3!5 +M32?U`MD=UD3'H#K(^!#S(J&B$"\4EH4M*N\J!2?6<0;Y!Q-)=,FWL:SEAJX1 +M;.')E%"]PMD7OHEAPCG!')R(>S(UG27KG"5H[].7G!@).:`0^)J1MC%T@1>& +MU_,8;TSEV-LGE7-WL4^0674GD4\@E_09M3#F-7-F/?[).K+(T])AW8F(U7.6 +MEE6*2CWO1^!/4ERC:`V&1069$+`,X1B@!/@$+2'!PQ +MILB6=VO61M[N^?*>5IF?K/_!M,S&827J*&Y$:)6\F/^0F>4?[*9*W&2+,G@[ +MNMU%N1CX+,PGD0TN +M&H&HCC-H/(&[-`;-[H<=7,86_8]142;9D=- +M.YT?#%^578DA7!F82L=Q:F9[Q0+(#=Z18S2ZRDL_S_SP+8<;'4CT,A1MT;BZ +M21[1&&2/3,'V>):K8C#(_Y[_RT3W8!SGB;I]%9;Q(BQCBDNGZ:_O!D0?JR+! +M[8C]&K>UB%A.`OQ[)_N`#&$U7SJ:LM"4Y3EMD"#)U"%)NAX=UO>B:5P08)OT +M%;GL&*MIDMPPG$=Y-V3``BGOFC;2?HTV2HD$_ZMH2S?V>F/D#,D8DB_HSALD +M)B:'SR7J17&0U&$UYJ8#6]XI._1:G.!:%8O57N7<96]I!.^/.GHT%5>@:EPE +M'^?]3)4#2"4R"V1N=N=A!7G7'+E.,V-.KO'LFN_6V$XJ>6\O@W1$\PH#V20@ +MK0+)@=8@E(.$I>=0O1+>I&Z+_.V,= +M$XN^I4/)>\GOJ@C6S?C=Q&2DIM:-9,^=X2)+W8/5>D"<.O$M*P5F"V^QX@I1 +MC^O4^9Z^J+\]CM#5E*-K0QQ=Z6JAN>)G4:8Z41=X692?\9N*-AT_R#Z(RD[= +MG\2:-ADR8'2K(N!?JWZ2AF!$@_!J6MM>$-]'/Y:9P)-29@A,9(V:KO!H0HO& +MQU60A\G!,/J]#'0NVTBN/,AGART/QI=\Y4[W/)C(\:'2[D];0:[B$B^4(MV- +M@(V8_Y^F;"=Y-+XVR""CU+T(../DR02?5JC"A$DTS0;_O59@U(OYZ?P\,-K$ +M.2\XL^4>5GC"R3HT'I9XQT8[<3M5@NV@T]FX?C`EV`G.]]B\1G6KF91B3>TH4W]J#)8Y!>.9JQN!9DOA(];B1`+<4.36KWQC?2JIU4OFL])TT +M^;>K#$+N'^USWZRV7$.5[K75YN/C9]9>Y^^_F(:=_Y62"'/TJVE`W;UT>@?I +M?7:W^J>31/1@)`^)AR[RCKY1I)Q*C&F?^YMQ#4(^EL0`^LG`X%:\BC[#)5;2 +M+N4&[EO#*90"!IJ7R&K3WOOM41L=[)R+V)B`@OQ1[OO9>-[VWD1/GR\F1KJR +MX^3SU<2*PV7/1B":,ID]BIY`:3\3%;CSR.(#NT<1& +M;3C9#50)BY#&TJG2FU7GN4>:'+=!$^/U.4C87^+0%K9LIE[=:>\V`>*L-$_. +M(9Z`#8&"%ZSC2%LS4*^;0F(%29Z*9IV*YO@>Z0Y&<.`&(7N5`A:V*0*7[XL8 +M;/S,P@4;9%%J6Y0!RW&Q9R#O$&(M=7(4]B"TKY'%7[TI0SL5=V]=>CA9T?$) +MW4*5'TD"<@-\`FTRWA\0UHZ#FEWQ8!H0J$(IUM.#*:=I'I9>-C2G0+ +ME(0]^E3I_#C>\&+Q(.0"E>JD&[?Z[5B'_Y6$ +MK:_GT'=G3>>LF[BU>Z-O8O\E:*<\-C9WGXSC3I*,MDS=D\$+EP"^UW^IY/H" +M?6/"B:O&1'5.6^P<^2:6[DJR;_2O` +M`'Z'[]$-96YD[9U17])9^O6)#;ER4^RML$UKS9X^GZQ)<[PMYY9 +MRZ[,^AHWV(_+=XOECXS$.0=0.>"8'Q*[_&?QTW+IDB)9;A=%E@=?)+DJ4+8N +M*E`TK2CP,A"2)O-F)"U*TW?6A:PVS[;T-$FX\JPRR;^=[CK:HJ7E$P`U9M\] +MZ8X+H+78>+U8E]/G(!<)6(+D!5*JF.Y-ZT,=D;F@IB4[-*0T&;7*G#D>94R. +MAY&P>)8I,YTM<]IXM'2\,7$?#&PN>QOHAT"R0\2,NO\++W4'/4"S-/E$QPI" +MKY,;V9I$+_'?LRT<:?;$YP<]$$&1%=LLF.3$JV<<]-.FW>UD)Z">;5J`/:,- +M%0Z*J!=;%+/RI$;I1%519-SKC8/>F-,-T1Z1'G`S,Y8^";T,GR.]:5L`[ZL44`U+/-978CER>Z>NU7 +MM%#]W[U?7RAV[U9[,J@L`2L'E9S9Q>E.I)%S\CL3^#Q,U,J=&.$WV+HV[VT) +M%O]B0T/#'[;*S5\P3T$#;8#?8T0ZLC7"&RRKP`Y:?-(8?B7)$2HB%72#;SC\ +M0:RZH;\K'Z(X`:E94>SO=>1K7Y,3<0..'IYM+8[@U0O+>T4B,=<;:5O=C:FS +M2$LNN&EO\XA"MX)F+=OO@GP8G9"K3>0!TDP=`.7^@T2!J<<1\/:@ADC=&B@%&\:>#*) +M^=0C%<$>--G+$'?N>:?>168==FS9VG0BACLK26VW5R +M*Y*1R.F/'7NCR),JLN^^*-]5TT$N4<`*7Y59RDIB3N-Z95$ +M7&FZGJ/":U24$H*5!+W(,M=1PJXTT^98C%:#'D,0D25@I(K,W_7KY*B'.$64 +MF@(F`0$2F)?BDOX+*C(\U2A/' +M1%E?-P)E8L@M&VX<+N/WN5U,/FQG&E!:XNO?H_"52$OH'I"6Z!PGIDH24X7R +MHK5N&/J3DQG>,+T&$C1TX+T@6ZZ.+'NV381_?J`Q%69[4%8/D6I$O4U +M7L$,L^P,U;^/X.Y8W(18F8HFME*D(>6K8W<&?5%\9:*WL%Z0NANX1$^+7$N= +MY%.'?,A_$K2?R8!\L!,F@BC"Q&HJV`V8R%HO*0W6Y-K4MYP9J=]!,0>;[GXF +MF#P9EU(V[^4!QX57]W?:S.G82^FCM?.TR,"O/,F=!$687@9%N"MY*S]K>ZKY +M>>ACS^)";%#O^L-]R-?3`IH.=\BX0[*TU@3CK_&#G$B="&J>'T +MU1S.E2:K/Q''W`2!Y%)&S&4$]3TW.,32$6T.958J+6PKCW2B`_5I13S]*AO( +MZA57PQ"@'C4@E?3435PZB90#-V)@I(?31*0T+6*M>+*,JJ6JT5O5;$H-I^\* +MQ9)"Y*W88]=K$='%3YM8H?Y&/]C.-9.'?3Q[[T_D;F"-7BBJ^H88*=)3263= +ML!%CR\O(`QKW<2/SC[[U6=X4Q8UOY[ZJTK[J$'N`G38'!^I#OE!O0!;ED.,2 +M(EUL&RV,[I?P/IIX?FNU:F**?_1]I1/#(EPW0I1D+;,;<2DWPD'Z?&IJC[I+ +M-XG#Z1EQX7P7T`7DBO^25AF>YA>I'Z[4<6 +MP*MKLM])JWQT5UZF+\EA")]=``P6B4B*L +M\=LV3]5(]UPH_!V!NRLSN.9W!*$8OLY"`@]YSLF6&-2#_6G^Y2V\DI@/:13D4!8P; +MO?TR+)0=OMT?:,R +M<==0`G[RGP`#`-*]TPD-96YD9 +M12^))5$4R>\C1>7)^MO3AW0UF94KT\ZLBC;SZ61<^ME469LFYM_U[T\_K]=% +M8I/U[LEE955729ZL?WO*L]R6-+OAK[QTHNI74VMP3>92$BIHK3N3<$[6A4WOS*JDY:0? +MMZJ_&PWMJ-(PUF-ZL\I)ZTL?-*AUX;1@U>[_K.)8K#0$I,$5WG$@5AR)$`AO +MO02"S:_)OM[DI./KA88%:>E',MO2QZ9/#O3)T:*IFNT^J88?B?A7_^$ +MP_*FQFD*7HP6[=A2L-CU(Z!TK`KC^1Y)G_FZ*:Y(%DU$LA2]?YT/"$3-]I6. +M(C,;YQC-XP61J06:FNRV%-7KI$C-NON(U26F99#9ZI;C)6P2X#ZF0*H*!^Q5 +M#DBXH&MS[CF:6/EH&#P"Z=[FZXG0U'>B8JMH:A@6:'(PVBH$(Z\E&,R1G!)B +MQPSS<,YQ@API36R:=,;;R/*#K@U$O#*GF>P'.-K<+G'?3T_9F7=^"9B63`%-SBA:*PH7QO/.=`9"DJ=?N[E'X$D`P^22B,,]X0G +MS38$:`[0BX8KP^1#%\)WB%'T&ILW"0'3UCX$.B]CH&M-^W],P8'>&\<%B;1Q%B8K^:?9 +M5@I/P?P@,]E(GDJ0`.ZZM*KD9^()Q)KLL^DKY9YLN.-`?L]AYQ;<6N][SH_J +MP2\K;L4RX.'1A_3['K6H37M8<7J#`/EV-/X,][(RE.);%"+J6'4?>+0E%& +MAI1.&<)FLI%ROPJLY&D)+]E'XF_I`;'DU\RYPW0ZW6P,E1*WS,2L\&'UJRE; +MTN1=F!CY>\,RA.@[3C-W3?Y1U7-$F8`D\XR3('YFK_F:Q;+JH(1%85--5%VD +M3./$Y;9@;A=F]4X,LXWGPL'F;GGS@<\0KK!%')4.!@V\()&FXLE,;6*-MEJC +MV6O:Q'XSALRJ`3ZVZ6&'\M.D!VX"\(6(T8W336"ZW$T%&$57)SE*(RZ,.4C" +M@UD&/2LFDX&0,L+:(#KKB7L50(B_4,.!'L9X+K*D_E66@_0K)B596A3Z@NTI +MN8QEW*W4CYE;9<2SZPW.39>3YM+B/BG=0QTA +MT.K<+Q+[X2HD_E-`AT%Y08E,YGHIN[7ZG.)"'$"2(4Q+'<^E_15I[9&@G_\P9(CSCX"7V==QRT']&DHOYJ"HZ&-JD@\+R571X3NK+,30TT@ +M=.'L/EDHP/^$HHIH8TP=.#K-`G4S-#S0/:HC29#=WWDFA_>)=/.5CC=\0M0? +MSI78C/@--ORB![W1`:)3JZZ=6B$1_P.UHJ*86E1`I92G7VHG"&CJ8,ZOW(92 +M3KWG3JSBDL?+S%,F<`&C4$$IF!ZQQ(C[Y_0\&7V4W69^;$I#QOO07*WU,A0, +M+8)0X=*14MH+&@W@G>&QU4B2<$+,*+CWD#A9?>XX!4&J8P4O1'T8WV!UW792 +ML8L>,*O:R>3Q;?!HQ$F_P".&"J/GZRS,[]2S:,(8%/1;_9JBAT%)>&T&^X.A +MF<1>E_]&B0][0DQZ=,?+BVW1O;O02J'WEOZ5,PD--5"4`L_9MN]>8E./!-/V +M62>A0;O_BZP,HB[T]R^4B/BZA(UHQB?>$WVDVN^UG%2HN\2+AIL"%MVKD`YC +M-R]M_*?EFR.-UJ_X<3B('CUR,X7Q\RUKA%%?S+',M0%Z^16PEN`]%%[ +M5+*5WJ$+6%46[SN+EOS]Y6%!-@8%G,2M/`RMEYN'+R(BK9=[R5;B=?*?``,` +MZC#;1`UE;F1S=')E86T-96YD;V)J#3,U(#`@;V)J/#PO3&5N9W1H(#$W-C0O +M1FEL=&5R+T9L871E1&5C;V1E/CYS=')E86T-"DB)G%?+;N-&$/P"_P./G$7( +M<%[D<($])$@.62`(@A40!$8.LBW9`BQ12TFV]1M[R/>FJ[M)/;V'7$1R--/3 +M4UU=W3/Y?//C9!(RFTWF-VU9)6NS*IO\G'[]G1\I;6#_:SN0YTZD"?O9K")IHZN#28N*=O+^.\Y^#9WA0- +MYG#7>E2UMYVQ.QZGIA]ZR +MNYDA-]H\6_?&X>C=TC2TW5JWWV*6SGD`*$"&QMG.W`0<+MMW^&#`<":'2EL +M2R"]T&XM)US,5SIV;P0^US+).''^-%8`D2G(3P=7'45ISMG6:K@0B@U9\!=, +M:,N(3*B^DQ5_2U8H?V,8^/M.MJS(R8!3Z+/7!/B_6:0)U%%2#*:&M&;73WEC +M0S,(7*S%?^*@1TZ`@Y&>,]ZPE7`A>$6,('-$:'\S3EC`CVRO:[K=>&C);.)# +M8@E+)1+6"N?)ZV&W3L?X#+L-4\1R@I\ZLS2D#V/!%DN +MIS)`M$5L'^2101P\IVD1JI)9S?,)>U_3=$+?AF-VGN2,C\U`RKJ-LO&OOQM/ +M*I;__(=)GKS]8FP5*6)?#%4",K0&^3QR`H@0XRI.*";>TA`\2*8@O`N!RQ-/ +MZ65P@,2BHNW%B)J<05K!'DJZ>)%/U5F9L6X4LJ!\G.S7'$Z8(*V-NO8RU9KX##\2BP`L$E/"!8S569+X-AY5C;NN8W^0 +MQ7KXTS,Y63MJA`M8?9OO9YN/AF7]?$-'\M$?5LJQ#J@^KU`D3D`3@/C%W/>V--#"&VQ,B +M1SS6&#IY.->85G=?K+A1:9&7"2V1\?3QB(9*WWNAVN5Q?+3A4']]'$2K3A*4 +MOXQ%C7SB8'=:35EE55:SU6[)PA_S.YXTRBW2&/QTUS*J+E-KVU-(AN[A'2@^ +M&8M'E,&A:%>"R!DRR0LR)*EY5NHS1AD3$/F.JQ\G=926TR,[-@K=&2;-:31"Y:Z@4@LJC:`2 +M!)60.T,$][F7_TK#E;@=V<-MUGF%J@6C?DKT<1"O1Y9<+N_U%7"2;](!G&0/ +MO5HK/FZX+XC4(7G+70D_='"EXH(.(@Z#60^'$\XD4P)&'W7JC+.2KP`102N' +M1GOVJ#/+*Q*3RI0R_JDR[ZE#S$@&2XC%\ICDXG(A4KSFG:1W:>1F0>(@5>J3 +M":B`E@I_(87?NA^@TH`;TR/_%J+.K>9(RX,#2ZD1@Q(=18!O05:EH.=>`.?F +MM@.M0,C?U*?NT3'*?N@/'6W#JH^2#I'G4JXS>W2= +M%!:=^:8U>#T8V&RXMK,4C)7;CQ>@]70K?VN#H&9T]>H\6(4_).]1J6K\48`V +MVYZWX@L<0K7B>Z*E4_@KH%`5L*G];A_9:?OVP!WC:CKH%1-AS[J@/2"SX&WL +M"PO/374URO*QG!WNM[<#3:A0@T6]46HY3=J14M]DWE:V5N%\VVIW^:H'93=U +M\`EI@P)C*^C+![3!WTZ[T0LI/*;[8NCCYPONSY]GEP#&-AS5*C<"&%IMMB3* +M[,L8^6Z.CIF\8"+1.#9`5^"4!9=R5^A6I_X2>8_\11^7F$]*=XO(Z&PCMYU[GM'QC-Z@ +ML24;^)!%8[],GJ*Q8!-J7*>_X:9",^>&+ZZ#*=E%EM,-]U$=$^-J3UT:G5:? +MKF443GXF--KX#*!J9D/OM/@`$`&('5L0UE;F1S=')E +M86T-96YD;V)J#3,V(#`@;V)J/#PO3&5N9W1H(#$T.#0O1FEL=&5R+T9L871E +M1&5C;V1E/CYS=')E86T-"DB)C%?)DJ-&$/T"_0-'Z@"N%8KC1(Q]\'7D"#L\ +M/JAI6JT)-4@(S?+WSHVE05XN@BJRLC)?OERT_W7WTW[O$Y/L7W8N#Y4O$IWL +M/^YTKKV!W7J7P:O5,=E_V_V9OBAK\YB>519RGW:'@5]._&A59HL\I,?DTLGK +MZLN@K,F+-(%EF=Z4]7F5UBHS\*GK1]ECHFR9F_1-1?@]*!OFD[W*?.Y&M=^5 +M)FU_[PZAQ)UFXX3@W<"Z"EI:TE1@KTO8"MU08:-GO9?T& +M\FPHA0(L@ZB"N>B5![FFE9>:2!3ENY#D\*Q`BTN?10BU@M)&9&\$?$AOR6

<0X,@)P!HR.RQ>'%D^#+5G"CG%YJ@C(2#"7#$!&6'!18 +M\OD]V_0_\&S*>D^8(NX'P4?H,W*O;VYKGK@\&B@<4P:%$20=#"O^I8$*0A7E +MWBOK)%LPI8?#$_GLB80&XK;-$-'_WG)?A(7EYY-4&F"@`Y-#(.:L^)R7VI8S +MIRT&ED\CT(XB82D,!6#!.O#]`E\-9O6IDS?`WV/1H@OMMC+)56NP[<+D6R-I +M<&[J@5+'4@HA!EQMW+9806V)E9U+=RA'J$TQ\I'8W2@'YIT198L+#:MZM!_* +MF`)Z@-W@^<`RX"CZ"VYC4<%<27GG(D>6A_DI5VV<%R-7SB^)UA&9D%1(@N'E +M1#P/`,666Y!^L\-%.55G7SI6=I$"`?48XD=A>>6MA)J)04>P*"<'559S&?`5 +M-1B2./.CV0ITO.I56<`J:;OVIJ!*>):]JHCG[GP!;;7\7JM@19]<+T)BXF7< +M)/6#*L,C'HG[ZPY7ON/153*UDUIXIUSS&_XOL>1J9J9JYN?`!`C)G9*RD,K$ +M&;#:]W.!?%):T#ZI<6O;`3RFWU(K]UD_QTJ"7 +M8!ML#UA1S,9;&!_*Z.=4*>:^7@ASWE2!=1]92!2@2)R(\$!%%>(TP#CJI+AS +M586FN-&#MEHZ7RLGZXE`!,U)Z5D[?Y%#GP><`C0/`18C,_YOP#D"8#'Q&H"T(+M=\53A#74+[(P +M3FZ.B%-P=0_$$R)'TO6879`;-Y%K1>[X6'Z<(\.XQ(".K]Z. +M6R[W.LQXF[G463^EI^-RDY&YPT7YY1*]MT2O@K#C)A[&#W>2[J>O%>.*U*(N +MK!%U\W!(%=M6ONIE"S[VC-/A@FV!:G#U("W!T,5_#Q/,-"M(,T9\,@3LY;_NI`:^8-P +M0PS`;MGFJ;4:YWPOH]8L]V">W_PG\68!U'>B>)'^./:,5<%8%0]*F([PY^Q! +M\RMG1D@#DC;R;[T%4NAYT:B^GEAZT:D>][S?5<3E'_P`/(.?OQ[P].55FJ), +MSF+X"@2>-8G00:9G:`J>*VM).%7]3+LY_-V@."C0".2S1BS\0;\I5H.O` +M5[=RQ0_6DO`).3YY(AEJK75,`L`C=:@STJ, +MQ185%&*D"0`#"B`"$0`R>:TN+3LA!^"2QDNP6MP)_(N>7@>0:;TB3,K`,/#_ +MB2W7Z0T`0!DX!RB4M7*<.W&NJC?H3/89G'FEE2:&41/K\01QMC2Q:IZ]YWSF +M.=K$"HU6@;,I9YU"HS#Q:9Q7UQF5.".I.'?5J97U.%_%V:7*J%'C_-P4JU'* +M:@%`Z2:[02DOQ]D/9[H^)TN"\P(`R'35.USZ#AN4#0;3I235ND:]6E5NP-SE +M'I@H-%2,)2GKJY0&@S!#)J^4Z168I%JCDVD;`9B_\YPXIMIB>):'!P4)_ +M']$[A?JOF[]0IM[.TY/,N9Y!_`MO;3_G5ST*@'@6K\WZM[;2+0",KP3`\N9; +MF\O[`##QOAV^^,Y]^*9Y*3<8=&&^OO7U]3YJI=S'5-`W^I\.OT#OO,_'=-R; +M\F!QRC*9LHFKZZJ-NJQ6IU,KL2$/QWB7QWX\WEX9RG+E'JE%H_(PZ=, +MK57A[=8JU`9UM193:_]3$W]EV$\T/]>XN&.O`:_8![`N\@#RMPL`Y=(`4K0- +MWX'>]"V5D@2``K`4R$$YT``]J`&H1W0;NCWT%'H!'0.N@1] +M!4U!#Z#OH)U%A]%=Z&'T-'H%G4)GT-<$!L&6X$4((T@) +MBP@J0CVABS!(V$GXB'"&<(TP37A*)!+Y1`$QA)A$+"!6$)N)O<2MQ`/$X\1+ +MQ+O$61*)9$7R(D60TDDRDH'41=I"VD?ZC'29-$UZ3J:1'0/R5?)M\COZ*P**Z4,$HZ14%II/11QBC'*!I^ZAGJ;>H3&HWF1`NE9=+4M.6T(=KO:)_3IF@OZ!RZ)UU"+Z(;Z>OH']*/ +MT[^B/V$P&&Z,:$8AP\!8Q]C-.,7XFO'9%YB,6A>7&DK!DK%;6".LHZP9KELUEB]CI;`V[E[V'?8Y] +MGT/BN''B.0I.)^<#SBG.72["=>9*N'+N"NX8]PQWFD?D"7A27@6OA_=;W@1O +MQIQC'FB>9]Y@/F+^B?DD'^&[\:7\*GX?_R#_.O^EA9U%C(728HW%?HO+%L\L +M;2RC+966W98'+*]9OK3"K.*M*JTV6(U;W;%&K3VM,ZWKK;=9G[%^9,.S";>1 +MVW3;'+2Y:0O;>MIFV3;;?F![P7;6SMXNT4YGM\7NE-TC>[Y]M'V%_8#]I_8/ +M'+@.D0YJAP&'SQS^BIEC,5@5-H2=QF8<;1V3'(V..QPG'%\Y"9QRG3J<#CC= +M<:8ZBYW+G`><3SK/N#BXI+FTN.QUN>E*<16[EKMN=CWK^LQ-X);OMLIMW.V^ +MP%(@%30)]@INNS/E1Y;/;[TA#V#/,L]1SPO>L%>P5YJ +MKZU>E[P)WJ'>6N]1[QM"NC!&6"?<*YSRX?ND^G3XC/L\]G7Q+?3=X'O6][5? +MD%^5WYC?+1%'E"SJ$!T3?>?OZ2_W'_&_&L`(2`AH"S@2\&V@5Z`R<%O@GX.X +M06E!JX).!OTC."18'[P_^$&(2TA)R'LA-\0\<8:X5_QY*"$T-K0M]./0%V'! +M88:P@V%_#Q>&5X;O";^_0+!`N6!LP=T(IPA9Q(Z(R4@LLB3R_A\0EQG7'3<1SXG/C +MA^._3G!*4"7L39A)#$IL3CR>1$A*2=J0=$-J)Y5+=TMGDD.2ER6?3J&G9*<, +MIWR3ZIFJ3SV6!JF;TR_DR'(J,GX0R8Q,R-S)/,O +M6:*LEJRSV=SLXNP]V4]S8G/ZU'&VE +M]G2U?75#]26=EZY+-UD35K.I9D:?HM]9"]4NJ3UBX.$_4Q>,[L:5QJFZR+J1 +MNN?U>?6'&M@-VH8+C9Z-:QKO-24T_:89;98WGVQQ;&EOF5H6LVQ'*]1:VGJR +MS;FMLVUZ>>+R7>W4]LKV/W7X=?1W?+\B?\6Q3KO.Y9UW5R:NW-MEUJ7ONK$J +M?-7VU>AJ]>J)-0%KMJQYW:WH_J+'KV>PYX=>>>\7:T5KA];^N*YLW41?<-^V +M]<3UVO77-T1MV-7/[F_JO[LQ;>/A`6R@>^#[3<6;S@T&#F[?3-ULW#PYE/I/ +M`*0!6_Z8N)DDF9"9_)IHFM6;0INOG!RAMJ(FHI:C!J-VH^:D5J3'I3BEJ:8:IHNF_:=NI^"H4JC$J3>IJ:H_R#W(O,DZR;G*.,JW +MRS;+MLPUS+7--:6YQ_GJ>@RZ+SI1NG0ZEOJY>MPZ_OLANT1[9SN +M*.ZT[T#OS/!8\.7Q=O' +M$IKL$@*!$$!F";N!&.@D!.AN6F&7?#2AA$3(4%*%IH4`W4``L8+8@E,J(ICF +M25-XS$@'*TQD0%N*2`=%4*@"DE:9%JK(/G_O;4JATW'ZA^,[<_=\W'//Q^_< +M]V:)B2B)6D@B3V5]J+'CM\NF$,T90<17*US+QTFFM>(,Q-J84C*3#A'E-@$ +M?41M?=/*V_L3!T'?`?W:DH;*T,[*MAJBLI]"7U$?6MD8MSKA5SA?"EU9&JJO +M_M/I3,AS1Z$>9V/#\B;4B6=NG+G?N*RZ<>FM;TY#`RU$\6?D6DK'RL"R2YV4 +M2F2S`S@):R%/(QW[J@ZB5]'=^G&JH@SZB-I%`]>2!MYO&(5XZS:-N +MQ\U2H;03.X6@]^@<]^5"H]QXPSB)/*.H`+$"M!&TA7;0:W28>BC".5S&'<;3 +MQC+C,#F1JY:>IPVTG5ZA7](_.9O=8JQH$)VH+9UR0&;L^:CF9=1SG"YP`B?Q +M?%[*S=S%=T1`.F0T&KM((-989#Q`1^EM.DEGZ#H\$SB="[F>NT6'E")MDW;) +M*^37#=6XAOJFTQQ:#H1>I$[XOT\7Z0K=H4_1@YU3.8/'*4YZ13IA2XI<,?YHW`8J(RD;&(]'1"_Y:!9Z-A%7*S\8B19^2#?H,>)"`_!"B-IZ_15&MR3P+-6GH:F==0*ZT'KNVT&U/L +MHA.HX"/Z!]VBC^DN_9LEECD6%20#(95'82IC>`(HGSU!;F-(\?1T45 +MO)"KN(6W\G?X,.@M?IN[^<]\G6_Q7:M*621B:L6B3)2+56([Z*`X*V5*MVS# +M;=DVC^V"[:J<*N?+%?)+\H&8^-@W[]V,=$2Z#)LQRV@W=AEGC1N40`-H'#V& +MMV`1>FA`#TWX7FRF;:#MH-W`\L>XR8=PCXYAQMV@4Z#3]'N@>@G3NPKZ&^Y8 +M#WK\%/TE`.,HF1--M29:P%/9B^[*07ZNP=UHY&=X%:B==_)N(/\:[\/-ZD*/ +M#]([?!GT%[Z&KC_FN^A[H,@!S;)Z?D(\)UI`K>)[N"$=X@3HCC1(&BO-DYZ0 +MFJ4=TC[I)](IZ0;F6&,+VW;9WK*=D4G.D&?*E7*SO%[^@=PIGY;/RM=C1L1T +MQ&Z.W19['5.9C]D4T,-/"F[8#^GG5"M6B"Y\$8:3#>]Z)S?1OT03)'.D>HCSB4C.'#TM-2A]J'#!XT,&5`_^1^??LD)2;$Q\7&R#9),+E\ +M:E%0T48&-=M(=>9,MZFK(1A"#QB"F@)3T<,^FA*TW)2'/3WPK/F"IR?JZ;GO +MR=6`HO58\FQ+WF+)?2`['#B@^.RU7D7C +MH.+3BE;4AGU!+\(=\:#U!+<+8).'$LW`&DT/K:JU@YD>/BU5]?JTH:K7VI.< +MOE"55EKF]WG3'(Z`VZ7Q]$IUD49JH=8ON_>X>4Z!ZQP_'`3F-,=_ +M,-63ZE-#WH!&I?Z#0SU#+<7M.F)?/=D!4(ZXI[FGF7RRP[XZRO^Z)FI_[UBB +MY7?\,GC)G/NXL)E)+4:9FE)I)5%1ZT3SIWHBA2LGP@U/@-%EG18_/1A.GH13 +MFNQ,5I7P)X1!J3TW'[:$>BTQSN1/R!3-<=Z_$=COE77*=)7H%%_J_QES>T!G +MHU4G[[`C%$_2P@78'F5>ASHO3D-YU`5#E@-2EDLI0M5%YMR4L!(NK@HK14HM +M!FYS6AP;U>%`#MHI]]?A=Z[?H7D":??%ZD!@$N)DFW%L5IQP`!$6]T98;$5` +M@'MP;P"0X/X<*_5KQX!B(``O]_U*P5?5V7MK'HV: +MW5D0GW/^.\-@'$1Z':L=:".?]CQ`>_U40GO"5$,[_ +M]NT//1,BBD@IX`@]M," +MK!P;40/TQR!7F!SZ6BP5*P/+C96+O3VVS90K=Y-3GD\.PYTARBPSE@\9G]4 +MMO(OQ]GEY(6_F2M/?+[GL/(0#3%E*9/BL="/T6/6B]N6C7,O"@]V%A64#7)9E%WCKLB`L +ML&:!AX+XY$,C$5U=*4*(&HRZ*L0ZID63\0,:$DO'.J:CU$*F+:UA'XR!Z-1D +MM),FU38?CLDX:<=)B9W.:&PZ3-I$P9Y[W[9)9^@?_:\[<\[OWG=^]YYSS[U[ +MWGTXNQR_%,(OY>(7:WQ<.^R<";2)ZX#KUAFN$_H/N2=`WV/Z7<;X/=<%^A*W +M&?2K3*O,%YG>R3T)>A6T5W%;8!;"V(3;HF"#5!//E>*K*(($?(7I,:9Y*24B +M7(T(KT>$5R)"7T1X-"*4180:(WX/[@\"CC+=Q;1;BB\7?EHN])8+SG)*^3-< +MA`6\DND,IM.DE)`P$Q+>#`EG0D)[2&@-";DAH285]\/G@H"?8_H0T_N9WLKT +M&J9%ILV2.5_X*%\XG2^\G"]TY`L5^<(%G`177`$;I<1)X4^30MZDD#4I3#XB +MO([?04DX44E"<=/X'0S6K$=VD"G\I1*V`1B%V`'RGB!1C^H0HW5+BNB!L` +MWE7$?(!KBI@#\%L5?J.(60"_5N1L@#<5V0WPAB(7`EQ29!_`!47N`)A2Y!F` +MUU284+S;`13%>Y!5<)E``>4<`6I\>)GT#"+ +M<6]L#7N@?PHP`DC7M@L-,OM.-,CL.W`WZS\-2.U/X6Z6BVWP#4K';8$U4^Q4 +MQ)7@IDT1%P&$%+D88+TBKR$U`EZ+9#;9XTAF$;8@F0U:K7C'@+9*\(7\'F9VFAT`AGXM3V"6ED;^*,^0S<3&Y*Q:3.Z*1?.IUD@\' +M+]!(T`?`R+:2#T0S>5^VD&NN&7(%SMOE\&GRAMA!+L$!>56:TF(IB?Q2+"6_ +MD!/(F+R=_$RFSY+)CV#,*7F(_`#&O2!N)_TN]?DAR4X.PB%Y!N;9[)AA-IG=JC%K;=:@V+J(5MEUJU=JHUK$TM5VUJ??N66LK:)NI)O0^F.T^6 +MR3FD$CR-*21(@U5(0&;N2[Q3-&E%PS1I?K+(FT^(;"1KH_PZ?@GOYTOY0M[- +M._A,/H-/,5@,)D.B(<%@-!@,>H/6P!F0(67JX2TI%T'=2M&;*.BU5&LYJNE[ +M#%YP'#9P:&6-C>M'!NXHR&&0YT$.@?2!?`?D`,A^D'T@O2#]#V]-T-'37#]W +M8-*D-@]P^V,/]W.'8ZW#W+Y8:Q_7RUI3@-0G8'0EHO>8-A9JAAO(!>XZ>Y,JZT +MKG::\U,(K9_&N[FRNC7T.=Y=&P):(Z.A8B$1&$_5&2H-#P7BX&TDP +MF20Q5GH2[J8LW)V>Q"9+9?Y<+J#(+DJ)>EQ`B+H\S)SWM=GK8.9NU=RM^L!? +MVWWJ<(=J=X#=\__TZUKZOXZ8&+AU;(1^AK4[Z[I`VL<'>N%+LZ\C.SMZ[%;L +M^\S=WM&YE>+FKO%;SJ[:\6/.VNSHP,@"YA%J'G#61M%(W>/KHR-25ZTR(`VP +MK[>)YK.-Q__#U[%_^VH\N\!D9^EDC=17\_$%S,>IN9GZ.DY]':>^FJ5FYJMN +M6\O2/=_X]>S=JS863L,>>GOED`MNN(FZK4B#>%0C9>CT!%X"6IYHD%&G)1H- +M9X_3\P2C=`-4L<()QY;5\-=IG@TVS06;35\$FTQS050=G`M2*2XJ,3O,>2`N +MW5_>NC^JV_K5R;-C_*172#R(R"4K9=;S=R"4*R-D'0F(7DY+0T +MN^:<8:,YW9)\W]&RB7EHFIMMKNNJO8VJJRV!``8I+L*;+.5E+JN>UYM-::EI +M5G>>6]/6>Q1;1TL?6U,Z\MZ1,9/&_L>'/PST1)3Y3?/AB=U[`MT7[^%&Q`J; +M#V)8"C$DHZ52K@$;S)Q>I]48$R$!26:=-MD*<21O-)Y+3$^QWG>L?T*-8W8N +M%D>0!6*VI+%($,_K+S,;,ISY_FU::EFKJ+_.4DQCOHAFE&<>/197#1_ +M<;!N;V!OCX)_C,].1'H"0U]\,C^CQK.32])\7_<]U("&I.Q07*NKU1-:'JI_ +MTK6MOM?U[?H3GE<\YST)A56V!'\#W)B73XK2TKXJ:$AQ&7R#!0>KI)P:(U>- +M"I$-M`7VLQI5H02N6C([_):F/'+.4FQ=5I%TKD[;Z+L1G(4]"LP%;U3ZKM@? +M7'E@`K'93==1]6RP\H[-_K$]6'G7=L=TW72=+A!#=OVE926+(=/EI6HSU9JB +MMZ958=;2\M;4-/K$F>/.X[.P-86G32#Z2]T^#-EAG?(J7(Y_Y__5]H"XPKNZ +M,7%==8&[UY#`/R;8:[VE+1R7M+8GX*M84]VZ +MW*NYF4XLZYQ5]7UVOGW(5UY<4>$\T6D,3"SQ;!3=IJRTI'#!DJNI_.:77;FV +MPF7Y!6<6QYL3X@+18&[@44YC<=(\_V1^D,O`EGI]LN.'?\ZAFSWF^[24SYG+BEA!P"9WJ8I +M2H;=]Y?FN9TYL86SO/!Z/KK)UV*,3S%FZ2M#FQK"/<^O.#)_02IJ66D5$G2M +MVC1U8T0VP;^RO_G-@#P +M7O(E8`-=BO&`<<@X8KQB_,9(XM,MB/,`TL`&SP`9/1.D4&U%M0\8T3L!AP`# +MZ<&=QOU&S)B&9Q66)7#<9B:MQI,"%,QL&CXWA!\B("'8HV.74XB+8REMN!W) +MKU.9A_#K2"0>`ZF:BNHJ/H$012A6^2MYFU!IEWK?7NR+NA)2$B/EQMU9$%_T +M`FZ?J_"TD+@U_J/GGXSG>TB\"ZQ2AEX-Z'CH$2E`P"W@WC,W7W9F>'1 +MX(/Z['!]-I5$>[35DYS[&JS5.H:I&J#1(-^S[Q'&>FB7*JIK*G')!QO:]G9M +M6ML4*IXRX[][^OZ][F7U-/3M347C2Q_^,0I7O''Q-\^^.R<\\\JY4R?;+VY2 +MK_(5Z]3F_)F*)_Z)_X7<@D;\#\H"NS=8/$4_D^JTKG%V45W6C<7=WM?U/?;7 +M_/U4OWV/]P`U8K<(HH?RT!Z/1ZKV5$O5WF:JF=[CV2,9[8)@!W@$FFG)(]AI +M2L>78^@A0J%"O)LL[PN9I#3\1*'E#\S0?'=^(2S\$WP?T)A)H3\@(7E7CD5B +M400-=R.3RMQ+95+<'5"?J3_'9;2)0&.11!_1B#-FAKL)%6BS4-VP9YCL#Z +MT-@M4ARBR6JSH&_-UOA;9#AD^,APWH`;T%/94>='QQN,A,^R?<5I +M;,7A2$ET['[F#J=J^I>ISUB24;22CWU0HS_0)'[R0$@)[6AD(;K1UJ!NT@]` +M907@.5)'8K%I.M*,=,HN3V]4%K:I\N_6C\Z@2USQZE]?A89CGT!&/3^!7'JY +MQ:#;UMJ^?^K,@/+3WG]]GAV2FGJ@56_6,3=/_@-BZE_5;]7N_YP1V.14&H+7]&1OY3]\)%L(MS!16(IWIK+4(6*25^LPXLQ$E(ZC#(@ +MFM1REVM!-'LSBPA@EZJT12P=OT)$QJ_`@0L7X/%+E[19Q[4L1OZ<[$&5C.HO +ME%7;;5!'ZY@PE:1JZ"8XFYI-=]*K;%VV7O@&M8/N->ZP[;"?!A8,=Q<8*!>` +M`LT(=1:&H7=R$QQ64&8Q&"C*8"B0:0IBA(\16$Y@#`6$FX#8=1K@9:X)-W2G +M8;^"]``GO#QN%F4?QQK\N-_/RD'$AN,*NY6[Q6%<&MX\XOM(/H&M`('H/?>- +M^ZD;[L\0Q:.@'GEC;6W6H85`3=LSESHB> +M(X>'A_4<>LO+!<1]N,:9&E@)BQ!KI2J-44&4(B1$(KM-"WL2Q/W#_`FUKZFL +ML!J.)N&9>7-G93O;ZSF:3ZB),I,XS3=+?08["V_#3]6`VDP^$=Q.+!\?&^S$ +M$@G"7>6,%X8WO^B?+Y?:&)A`.&N8(WL@_H=T0D2(Q\$^I5EGMIM7"CVF5\PC +M)IW.O-:UIN1%UV?"?>%!B9X(`5&493(DTK*/B(4MUA@I^==$X^_$(!=38L_' +MSL>(6$RDI2A#8^&HVRT:BM)P_7&6+7582Y^_F\"MGE;\5FNQE4R4S+^PM=]F%1(KA]Z[A(UOWM?U3F2*FLB^Z2K=M^O3 +MQE)'4A +MD6GQ`1=TI;$E@_8R5B,=MD2I*BKR\B8^RF#>:``80G@H%"`5LRB93"Z_(CI% +MR>7R%RM^40KN#\!E@?6!G0$\@$`\5F(KKB,1AD=*&L+1[C'G0PW%5&K,Z481 +MUJWAYZ[+UKJ=DU7^$DH;8U_6?SFFU5LRJ6Q&BWB0J\V#6UGU'71Y7SG,@2D@ +M"\]MM"22\W,H+?8GIWE;B+S96RVI^([^]Y!?8+_F]I:Q_BBBU>,60Z$G# +M`H7R42+=8109)@TKCM`=NC2T*&Z\'"\O+_,'`GX1%SR2)/R?[FH/CJ*^X_O; +M1V[W7ME'[G9O-[F]O=O<7>YR69)<2"[;8J#(!0& +MQXZES%2EA1I%II,9.DJG9:R5,`E6&:L@:#!25!AKQ6EM0__=@\?1,Q!YOEVRX:5:S%Y>[U +MYHW$D@MG@(9>@EX_TV$;D!.)E5;JP8$R-[&AFJ5Y!+#06B$JT>:Z-1P +MD;1-:6U\VB*M=;*%SSK@1'47&*AU$*YDZ5<_Z^M\M5JKCU%N>2KJ6G'NE-)3 +M]>)PIE'N14=61%K!E>:P@8ZM4)ISD<6%3CAWIM"FWE68G\:Y4`]V:9G,4NDT +M`>_-Y>!PC\R5I=,.3EX^K:P(<5C:'D1PT8SWAE@LC2`EWJ)Y.'-^Z)6+]9HB +M6A9"_AE=8^*2#YXA&K@?XN#WD3S&!RP0:)Z!((RA]R&"!G4KD_V'12FX?KCH +M[F];L1W@@;(LVC9'[4/'^]5L?W\A#>Y+HURH%[O4*W,XW%%6[IM6EK9:JFSO +M)R'"_0P@/Q@).,M;))TQ`)VCO\O``9>%/4_9)2+@`!X0?Y +M7?SC/&X+K51.#^.62#POB3-":XP;4"%$`48`Z],S&IV?M&P*E(3@EN^W1G>& +M]4KU$C77"I5T?.>=G6O';O1F[[RQ\NNRF<;;MD]G.FH/39JSX!HJ$<2Q$JXA +MAMS4:ZN<`*-@Z0@Z98X2795N4>ZD=E/.O21@6B2/:E&95\/8/8@4&P6\SJAX +M7"+5"-L"MR42_J44M0!P1\(2B^$QQH57*:,W?Z*GG'(P!(MKB@T&JUS4?AG( +M(34$0L,L13E#-#@(*S7T&5+YH\4P$1&QIA<^5#]R^<`V*@WT,^!F* +M#W1U#126]_:5F\YFDZ"Z'C:5-%BT"!M?TD2FI[NPHVDRMW5ZZZ;;X?1@S0;V +MR8TN_.#TW6M6$FG;U]MO7B#^!:?)"QN`C`SIJY^27L1?)$\R;W`$A3M(DBX3 +M*(FX@GQ*7"8ONZ^77V.N<5?YZP&*1$C"03K<9719!250E4/,$/=DX$GI.'V\ +M8D08J:3+M"#FU?R4C,DR*U[%KCO19=A:#,7Z())K=4I9[AQPHLX^T5)5)60E +M:(.&AU'R(#MQ`L-`-ADJ-[N)1B-AS,HX;"/"^QD:EB)++&DHK1$<65KWZK-7 +MEJ;J[KH"9I\]?_XM\TUS=.*5-\9!.Z@$S/Y_@D[097ZV[[//]YF?$QM.GS5? +M,E\Z>_K/;P$5M$_\J1E3QL&E):C:[T4.)TY$3H'7N5,5 +M9VK.)"XFKM65.P")DW#]C@H'S_,Q7Y1?']L8WY#86K$CLBVUI_8`-^0[F#@& +MCN/'R3'Z6,7Q\%CJ)+@,/L&OD,%`5:6B!]Y[R%NF:1"D*`E'K(K]R`\6^@'M +M!_Z.J!Y5O%[,>0W[SS=@JR_!EK1@JY]U"VPY31P7H1M!IS<,@][YSFM"$4A: +MG!;/O@-+YR-6$_G_<#J"P.(P;]<1-58'K*)BX_M->&_T'ZE]=7.\.>E>NV/! +M=XZ8(SI)!A[>_.[KXV#NMZ%]<&))\_ +M$H>@#H20)')$-WJXW>R0!ROS_-B#8BV(%%)5O$6BU(C4(LEJ!)/$$!Y+L@&! +M7\\!CLNQ@A`(2*P@<;R7\XL!-CD@SA7]L9A&H2%9\$L\&>GS\JF$-(QC4.I> +MF)?JK(6!:(O-X?<^L)S3>A)>N,1D?6(J^E@T(2 +ML63<`K/(VZ^R)@029G,KAY<(B]@9TTY)RD!7*K@.W7=VU]4?KEP'#C+12M,P +ME\V>M['0A9XYHF2&%C>FB8[[L3U;58%*)Y?]]=G^>16%,:$:%Z+&'W1='0Z4:<')'%UI920X$7W6R_G)SSQ +M)%WM##N:'*`U#*H=(!D&\6J/$\=EC<-PK8YJQ5I;:4E:]0L'<$S222TYF,22 +M8C:#U!\(@_"D1@_"+A28DQT%Z`O*GC-VHS2Z\\94]@YH+_#FXZ]H#L40\MR> +M8!M=)"=.BL+4.*!S(DQ1@HC0]IO7\J4WHE#43*[1GMEB!8+3VI2&H6HF9Q63 +M*4P+,K##/ZJ$X;_LMXX(Z)S3<&GO3[>TU>QXY-2B11<^W'2^/"R2N4S-Q/Z! +M;9F65PZLS=W_;_/+MEUM<:](A01J#O@"?/CWMQ]?T-<:S;7?T]__Z!,`[XB% +MS/:G/]JTZ.Y9]:NZ&MLV/_.TF>>%,F?Q<`H<#"0']@.(##.'&OSNB8 +MI)Q`88A;A0ZBSZ$X.HINU'T.]SERV'...<$"C5W%#K+/L3A4B(U'+9?GK?HI +M:%!@NHC;A6RO:/83OQ"G#A62,D;!!*($Q*6ED+)85@'89#LVL&EO1:.L16Z +MZY:MXZ"PC1L,1J&%`=T+URMOHZQ=H=U==]#M!EUO6]8[2E=&L-DCR63=.98N +M2OYY?OJ^?'[*F=^-=:=2\]*VYX$+;/, +M4JT0^1&'OC_1R[7]YI]+ZOK&P9LK"ENV5&Y7]CX[+[\6O:=:G5+.'2\OV5W< +M31@C#S-I@S03%9I`G*#^!^?<_D,6`A"I`_!]TLCNK5D^;_X'F#8YL)SJY +MM,E(O(]_I-9$W5U@(NZ.N2JCF@Z45`JCZXVLM9Q"EZH.DP$/ +MY$7,R>L:Z\M/HOLL$5>CU0!!!C-[%\S$%&?O"\JK?;6:>L@QJ0=_57RBN(3H +M$0%I12X*&[L*I<++MH,M!PLJ.VL+T2T18X@-!8*A2$ND,!]LK_]1XN?@4.)0 +MRZ'":7`B?"9QIN5,X:WPY<1[86:_`J>X,$DOXM'^5/HXP+>IA$$VK].>$?X2%`(I]`5Q]KF +MPI(>N7:=*!-W1L;*-]\5W\J84]9K<_YMYW2U=Z`]K\@%,U*0RR4`05NT(!QU +M0RW@TBFI1T@8:1XX?MC3,/(R#6+O5`E<;F_X.J1[,`W`9U$GL[BEE`]6O@YT +M@.Y9D>W0:`RXN:>A:`Z'%S1%'KM`^=_Q;;8^IR-K7 +MCBETT/\L["0>ZM^(L,AS0F=14R2WVTXZSI/G;1<=M\C/22U#!IS1FE'-*#EJ +MFX"!J"%8X&4];!-+UQB])EJK\%I91-MOQ125/U;N*T_' +MG='*[7.5RK20VJB\+L2T]6+F\0_^HE@#]2=FWI10#-JBODA`,6`>]@TS`^Q` +M8(UO#?,KVQG?.?*2[QYK(.D!9AD[RAP@508&!#$W9=<8B:,JH%+9"0(JS=[E +MU0>#J%^ETJ&M@IOYE`(4',#)L%58!_M5E)68?O#<\.SN2^X[UZ';JY*2Y10? +M@2.`/Z*2QD0/CR!V23)B3642*8$`Q9!QR+G6M=KUAT5NL%BM.,1VP2G"/AT,QO,NA]V-^OUM+36O] +M)BLX:OW4BEJA;DX$&+].<(N3"+!P$N6;4#9C=Z:_Q&`B!92;1>\0E\0AN"%9 +M06Z"T<+8Y>Y\N!J8.1FBK'4SQU8=3P1PK/QOC&F>ZA1"N?ACF_M*4Y6[:`)- +M+>QM4GX'?1.HUCS:,9:FGQX^&*.$FMWYT+^`ZJLG=AW8"[9)?4G#0].JYY`P +M/&OVO`YH=%J]4^?2YW0J)$R$T2"BR"*><%-`P:K"#LKBHS@#8%3K?5Y,K0Z' +M=#!_8?2N$K0VD\?D87F-XC2Z'(G$[\/SO`W/=5^D';'VRA#PB)7J>3QG;PP/AP>Y5X?'PUNC6 +MVF]GM\]Y*7P@^N/4H>RA.:^G3F?O8KC;'>T%5H4\X(A16ZO +M`Q0<(.X`)DA,T^W^>0HNE]#F>F-:+H:9N%Y3$2L6,R$ORJM]UEU0(`O:%V0& +MU6>79T!FL/5(!^OGJ6?Z6PUG7^%?A:TV.!!_ZX.1Z3NPO<;+SH6$\]J(LZ>Z +M*%T?$>UCKHJH+(/&].8;SIO3#X%>_#O\6AJ_&<^[K\CV0KXWNN`5&]V!V-CQ<*3#,?*?>B`Z"_)DY0;#U;=,.DI]N3RW7V9B6V3 +M&[IW+%I=>=6'NU[O&FZF$E.=JR?__-O.;S``/Q"._I?NLH]MXC[C^/WNSJ_G +ME_/+W?DMYWO)W?D[_>C;OB5@]][M'/8+SS=UA;Q\Q);]7B84,OPYIF0)_GV\T?/QKS/*9,]%X=DU!*- +M*7$!1S$4C7?_].IZ)9:=PL_"N8:9UF1@`KFHSU`$Q:$$33"H@W8P5MFJA.DP +M0\NTHM(J4Z$KS&YZ-S,I3RIOT6\Q']`?,.?H(SXE9XPG<;4!Q'W+:$0E/.:"1)^B`&SR8=@I@TDN^V +M7R=5TS3?,5C877>#]ZJK,#2,,T)V=\^9)]3UNJ'QSM.S(V?3);K,6+"4]HJ&TJ4:P%1=TNLNAB8UJS +M3S0*9T0V.B4R/A*C8GUVD+4#NXX"RAJ+.BTZ1P!"(%E8^XF%!9-S!@G\:W8?TU:R0KVPEZNE_FJUOU2M:$$VV0L.P9)" +MEF2U6BK!U\,1AS]:1BN]:2+_:-$LH][_];#_&>07^G=?#WWF1&E[1*93=%J- +MJYPBJ;*24M*:I,E:2DN7I;)<3I73$]*$O#.U,WU8/-3\1NJ-])7P/\*Q$_() +M!4V$$HH<"8<(ISV(V%@[X@NR?FN*:\(0ELTX0T08"R0"\"M8XA@+V%9G0DV: +M+8<9X7H-&G[RTRD?TS%G%`T%6&*,`&@L+=-A7PO">M7`\/7+MMX+H.%L-!P^ +MQ&Q4O=M:.MD!]@.<"19+X*,^J=3[,W#41?MK0DKU\7],"^5:*.=N68<'^A/N +M_*,?``NCNN)!:S9K]T1Z3RU][B.P7`[U!YQB%@3R7PQF'#GS)M3[/XEXD5$] +M8;6Y``(WP8,:\^_5S/G71&>1]<#_.(9Y[8C7XS0F_4.'$\ZYT6W2[/9=H].P +MP`VPRY8JTD/.72+G%=2\ +M6BCWETM[^#W"GOR>`N'@'8(C[RC@FENCA]QE>J!KS/>QZV-JWC5/S7<1%;XB +M5/*5`DXZXAS*MTKI?$GK!?V%5@%'<"C"0%>S160=T#"++*>)W;V!8%KK[=;2 +M4HRPX([@`-<).D>\P0E.!>I(*.2U.:P#I7R.YYR#1DP)1V-)>1B1.`D](X&L +MU"KITC'I'FH=PK;^Z89(%LZ>O>0"Y5[Y+WJLN`Z6@PANGNJ4-F!33P +M-$P99Z.XNGR4:=8AYPM:_32O!<\:[GSM`=]."9E^<*#0.O[XW.V7S1$;2B9^SYXP/20">_?JBYZ_"/ +MEY:&%&LN9U<&P?TGMSP;J",J9U/*X/X3E5WN!K+0.NOA;4\@*G)!GPEPP$V[ +M&4S&E#`1HV.,`?DQSS@]SDQX]M)[F1,>`_.GZ=/,!?H"SF\2V(%OP,2M&0?OKE>Q$Q!:) +M6(C-?N#7+49>BHV'05@G#.,;B\+#=Z]*+AJCN&Q[#3\"_T#5CQ3RB)D)D39\ +MU9Y`JQ%(`]N5/P/LO\B-J[7_@#0M3N[H[=\Z*3*GT%G`UF[?_*1V"\3G/]O\ +MVO6["Y^\-CX''I@W3*I5<*-"-[P`?]!?"4;$IA;^:=>FIDWLY?#EZ%5^GEMH +M6F#_SGW)/VCR6IN`K4F)=$2&(ULB.RT331/L]RUO$R>:3K`NDHZGR0SF$SUL +MIJO9+[)TEZ@6V?1^426<#KL%4WRJD)%#?L)N<5M'8S;:ZAX5B$S:,X8!3#\& +MAP6*H3M;&4%)^G4?\"V?A0=5TPI4[YD>^1[4Q,>8"PD:I[%AD:>JS<45.QRD +M"V!U3!J+&40-%Z90AC&#XX%>5BA]>PE*M72CU)K6P<%D8O@[I^87WAU=GV@! +MP#:X<>GFIN,;WSSSEQ_[G]>^VLNTOJKP[Z- +MW9:DH>)2,H=PT&]LO&+ZA2PQ2#,=P4HR&@QS$,;=5HDB;>U0B +M8E$/QB5IQDB/28>>,$;'\$PP/3ZH.R8H4_<2E.F%ADXP2M2#X]2:Y/B5X%@L +MK-DB,T2A;>@+3PP^]OR3H>1,C7YT8]=Z-7U;/>GDX^._N?'-;P?0 +M2.^.+][_^?B[Z#9`)4.%EQYV]11LN6]8-FP&\70X!:C?&;=)@OEI!]2%0X[J +M3XEDI^M]\BQYF?R4O$LNDG:+"\3C)(=R#DQ$6&[Y;D2GV?AY,4Q3F"^*1;DP +M8<&8H$["Q##B@;>"BSM]$<$I1"'GX:SHCFW"?N&F@`E\]GK5M(]W&Q[*')@U +M\T)V5^LF'Y*D[W]T5UN,$]<9GC/C\1F/+SL7VW.Q/9X9K^^768\OK+UV=B`! +M[W))LV)#"6BA*G=5::%1G%*U*4E!T#ZT:1#1%JE-:0")1A6MEFXWJ5158;L" +MM&V#LJ55!6D5+LI#>*G82)%8TS/V0NA#?#DSYS_GY;]]__>!_X.2+K7Z'*+C +M0P4<1VSQR,I#X\.[6K65V_GTQJ'-2Q\68:;1P/,V&)]Z=N?8TXVGO[UK6^>[ +MNTM4T:Z#\H.;^,>HKVI8';MI90*7NY-;S%%>%L^EN7A^M_N2 +M;RXYEYI+7TO3KZ%`S8"/IFI35F4&N'ZG%=X,@=`,V#RC[6I;(-JQ!I084 +MK:9C^DT=Z*_^@OD-\R?F?<;!-(:,>:2<)N[=DIMWF;NRR-B[]KTVVMZ[*\IV +MZ1SX'(M0(!GY$QEA%+;\[`U%OH2DCHU'R80!>M((11-94%G%"F"YUJ*@*X;L +M$!N@:X4Q4*XIIS=]:6TJ6)S\5KER]L3*USDI`//ER.'-3SVI1,;V[QUXYLR9 +M],9FC'=!5F**X#E0/7ZP55^1#(AKAU:OWO;2K[,!OO//O2^OS_7WQY-5TWCF +MQ6_^F0UX(!Y2B3M=;O3@-OYSTH4IV$XKZ@Z#0"O`NBV@N;']E,MIA35V5'*K +MEE\+M-PS"(T]%M0H;R:"H2/%)A%1X[Y\29Y'W24W_R+*M]K7T786&[Z+'L/S +MMG6^&ZRV80>$KU1M@H"<+P5BK+^+U2L$Y[(*9+50JF),K"]?O.CU%U+54+'? +MW/R]D>I>XMF:I!?+NU_LG-VR-)F-Y&NF.%Z9")5_@$\N:XX'-QWK4%WUHXYZ +MQUJC2V"]=[T/;W@;/MP%*4F"DC0461MY#NZ#)^$Y^"Z<#LX%KP7O!/L8']./ +MZS$ZIOC>C:DQI;\:\P\Q,5[QSP"?E1`LE[A*4$6&=I']/LQID(`<#8<%=QS& +MXTQ4U&E7IH^QZ6L29-2H#/@K3YY0]$(I4L;P.3`FC_N>'YT +M8'SKCK92U"HZ#8[5CP[+A9=/X:1-CN5E7OS@ +M)O$/XCS"GN]8-8"Q"2$AXBZ:;G$(]B@(,YPDB1*D@Z@21,#P1%3A5*Z +M-E+E+G`X-P,6+5J05'%`O"`2(MI.C:HVU%QK+TW4;BQ-"+6V#3>V9D%=0D(F +MRS08B!:[()A_-0#RT)8D?(E_)%N0SR!&%$`2_2JX5EW1YSC)_)#VUE>`:KHL +M=:;+G\K%4%C-$.=-W*]16;KS$M@FE?NR`C!-PFC>_SN^W=I?J88=YD-?R9/( +MUQ*JX3\`#O"D3.N^&,=Q?$"2=3DFI*5"(I,T:E35-2BOH=;(X]2$:TM^CW2P +M<$PZFCE6>"-TCCHG3W/3O!IV)*1>I/+Y7#:7R].94#C6-D4*K +M4*+9C);J3UO8JO3(?O80^P%+L"VVU%\IE8VYA5FVUFX:$V*[)E^1#:[6E&^P +MB)>+;:-=:]Z016P8B4/!#C="=4@R[>Q$FVE`IO'PI9D5F0:%DH`W8)-!&[+1 +M)9"/)0)EP8Z\]H6I05]@WP`?QW).UZ3[B.IF(GGP[UP%TGL]QPE'J0B"\6RP +M\Y[Q-]=G9N=JHM_.%2'$/$&A\PTP!K\6"/M(T\0YN2^I=7X"CM(FI<9GM7]_A:G:BJK$TY>TU1=9YV$TRR;*!V:SI9- +MU31@N=SB",*I\;Q?/V&<-G`CP^FL;J*;\`1[AL79#`<-J/HARVM$V="=IH?& +MO%*8H)60['$[02T5)S`E,51/TKUS9WRH=]T9>ATNCZZ*[M]!W-GA6F`Y."[>#MX7%X*+@(4EO*9A,!M6($O5&(XJ* +MJ4!M<:CME$@DP_E\WGS.Z_-%U!PZSU-^7$BD";^2##AQU_B`KPSMXW+YT854 +M`$N!5+44J!ASC>NS77%;,YH&^HCV-)\??IB,G@WU$$(K>^TF!K5-ES@R5VQH +MMT,?[))HZ.]!]T/8^J+F\0$;RH$V-E@<)OU]9C946@8S'!MH0L\IYONTMS8( +MJJE2J//7\8.O;/LJ^,][J^JIO#@&.WL!`>4/-L#OGCK_OL? +M_7+'D.,JZAE7YPS^*?DC+(%MMTI0#LKO]!$`4JPL_:RSY*S!IS,GSB*;8/:'!S&/#E^0E>;:W(M\E0[Y\ +MN3AP!$QT'4:\I8+JKPG**ZJVIXC4H)I30`38%::B^0Y2)%E,ZZ^(T9_NJ>\" +MQH^_CN-X\JF%7QT_=J#SP9XZ2&5R+8%/N&#LA4.G+GYYLNS^[>%#;ZT[_#_6 +MJS4TBBN,GCLSN[.;[&-F9]_=F-U5D[AQ,R8F&Y-:7$-43,S&:C1HE5@Q$76M +M^*I46YK:BE2E4,'82D-CI-0?(BJE)HV*J$1%$<6B&$2TB)2B?T1!$'/]]A&I +M8(B"=YBY9RYG[LPYW\PWW[6I>[OZ#GYOJ>A>V)O)!_K@;V(@K6UQO,PL^^3C +M#I'Y?:HLPVZ+VT>%'(K*XB!M!9H=!:+2*5D^"3M)F;S$5U2HW[[Q?VW#*]/2 +M@F*55+I-83&*8=#C3@G*9RXJTFS,3B&6C2%]T]8]!_^N+20]JW8SO;6Z;5^^ +M]YO0N#*#H7KYX/7!`T;PK*Y0/-,CT:N +M]"[L3NGBC]A:R2Q$(,+Q)WX1F0&2?N[V.>@-M-P50ZZ0)@6>WQ3!`>&F +M$#!LI]Q8]L=>E7)D#RN).W,F*$R%1Y2L+59FW295:3XOR7WX8G$FZ3QY<2M= +MB<4JTU7IZ'1A49Y9!E*\CB[2FW)RG>&'[R/?;O\@O^?#RX'O@S\ES<_+YEW")G,P=*]DUPBQ*B<84:,V%BV +M%T0)!J,,T-\8N31@L0(VZNT*H,*A.0&7FUSUIO[4R'LUP:C\8"@\>LS8`A06 +MC8L4CX^6Z!-*RR:65R"&RC?=L8KV22,_V/MJ$B[0L83J.8GT!!$A/!$5M-+Z +M"#68AIEH0"/FH1DK\`6VX"OL1D=0"_HXI^N"*,)XE!*_BOA3B3\#LXC_,?$_ +MQ:K7^?P>'^"W^$U^@U_GU_@5?IE?XA?Y!7Z>]_.3_`3OXW_QWWGWW;%W@Z^, +M?_LFCL@PH2T[KT@Q&PJN1%C-8B.A<.H-D=V%D7:E&"VG;1HX)4&C[$)#_-5^C,384F>3QZ(X6 +M^^2G3#6ES\^6UJ\SP(5$Q(0\R%TOB0MD3:@8":\L +ML!LA`5G>NXP#NR2!$(V))D*%;HR-BA +M4$:@%1P=E:GM^"QE;[][@Q2\__SG?S_.?\[=NQ``>J`#"H*U38F6RL?>S@*F +M'P?$IMJV5OW7E945]#@%J/GS6N8WR77?-Y'_C%@\_]%%\WY8F!4$,C\"0BT- +M]8FZJT]=^AB(GF9,>0,5/?IUVP%X,RGW;VAJ?>+K^[L]2WD(Y<\>;:Y-G/OT +MQ-VL-X%R6U/BB9:,7WC^QGB3LOY8HJG^_E4=[P(S.]C/O2W-"UO9)Y^9<=O> +M\O/ZEO(_363^;OF`^ZBK%=)5@P)BCK(!O0'K,O$J\?/T&,"VI0];?U7Z,7JO +MC3)=.0+%R$<[-C)S.R[B?F3#C\MB%.6].(U+F(!9.(YJO"$>1!(/H0)-8B3Z +MBP]1CC!^@R.,6(1F^E;A5_`QZH!UC+IRO($4OH47!1B)*+.LP[#"GJ(PF3V/]"=KH>+W*&K^--PA_Q%T[>*PPY6G;(KY4L):A.=K59RZR= +MUA'K`YZ("STY_QK"!+3B":S"L^SW.>S#,9SC67V%Z\(C,D4V>]@K+H@O)&26 +M',!L[RO-2E+9J4+=I%YPC7*M3&]+7['F6R]:)ZWON7L)#V?OQP.$H:Q1B90PXG428JQ`@QBGV.%2$Q7M2(26(:SV>FB(J$:!3M +M8JEX6FPB;!9;N8^]A/WBH#@I3HNSA"OB2\)WTB4],D<:LE@&90UA)B$A:V6# +M7"";Y%K"-KE3[I4I!4?^M +M?NO*=)6YIKMFN'/<%>XV]RON/9Y'/&]ZSF,W9_P'[NG6IQ:+Y$OR/U@J'^1[ +M]AX@WY?C>!+M8H]XA9-ZE?=V".$C0I`PF-"-L)PS'!B\I[BHOW&W3R_L5Y"? +ME]LW)_NN/G?VOB,KLU=/K4?W;MX,C]NE*E*@)&Q4Q76S.&ZJQ<:X<0%;-A)4 +M)&Y1Q$V=JJK;?4P][KCIMWL&Z3GO)Y[!+L_@34^1J8_`B$")'C9T\\\A0T^) +M69.CY->&C)AN7G7XB0Z_WN$U\CX?`_1P3D-(-T5<#YM5;0W)<#S$=/OYHXQN +M@1)>#$ZBNYW8Q-A$>T,.B>T1-G.-4-CL:X0RZRCXW/:DGQ]N%CF4AOIDK)3; +MF1I=P'5:U&<&8WDWV?I8;!CS#++SJ$Z>9(P9&F]D:'0R,,%U.I64U'!$Q9'H +MY*C9$]AP82*:T*\M4YF"* +M6#+9)1D^LS.9S$O:[T&7G!+XJ2)X0Y&"DX!7)24Z(HZIP_#EV0K#9_C85BS$ +M4F6\7C\>+U\:_A]R(TU&>R<=3^_P'+0UMSW#7"?@DV148)9[.]KE=LPFEE.W +MG+A25D"E[3*QB3B2\JN,Z>>:`8-XGQVO7D:VNA#9Y`<[^;;#1UIDZST%CGXD +M[3[B=.KR*>=[UL)+VH<84-:BAKD]I*6D@TG]S.$G7TZ\@S7]LL)*DE?)%[DK +MF`L.#B%Z[1CZ>Y4"--#>UXXA%C'W0%*#F,_[-BC8R_O!--%KFJ@\/4!LF2:" +MHS5QC2,I):L+NM6N\1Z]WBJ]&3I$KU/Z7"M9._K()7W8))[JC, +MX+=\)[F=Y"2V2!MM;AGGMTS:-`/KR*\CWR%=I!G\(C93TTQ-,S7-U*B80RG" +M"G.OI<32??_C +MO.ICFSC/^/O>^7R7V(Z_OQ*Q`,.$CN'PL2A8"X:-T +MZT)*&A:*@NA"LHF.D8U.D'4P#0$K98Y#D*%(G42V#G5(3)O63BTK53,ZJ612 +M6XBT-';VW,5M52E_3#O[WN?N^3WW?-WSON]SRE/*DTI4`)?73BI.G03>DXEJ +MCJW/X,\GO:RK*L!F\$@Z607D6#KY&ENOQT=1A01#1(.H@A#H8103Z2'L$6D_ +M]HCX"VFN`A[K34=>!=*3CDQ#.O8CMP@^D_9.`W=E.MG!UA=@;UYG#8HQ`GTJ +M'1D%N#)==9>M5V,G_X%K967=&`IPG[@P#Y,.*#/%:FKW/`>&-['MKQ`%S7E'?Z:1(?E8!S.OL"*CI +M=6?PEC1[P"M8D+'[0>,S50EV)[#/\$K6715D-W-OL)NX`^R&14O-,9&LX6Z* +MX7S.*^HM;#UG8>LB=]G:&$229D/"XVG6MVB\QBV&5QU9Q[H@/,EUMC)9S=K` +M).:?8I_>0W^;?IH.TG[:0SOH&A'FOH:K +M%N'61;A5A-N^AMV+\+E%^!S`2^;X_SBZ&_XWN8FVLT?'A`ZITQ[OAK,S]:,^ +M:`('NY8O'S]Z-M\Z.3J[=NX5Z([NU%E[=RQUU!Y;/MXVM@0\)L!M]M@X&HLG +MMXV/\=VQ=!O?)C96$T,G>N+?L#7RE:V>$TLH.R$HZQ%L#<67@.,"/"38B@NV +MXH*M(7Y(M"7$%M^WN:%WB>/Y@P<[>GL[8!+`-Q2B7J$2L.+3J/$:@9LI*4QW +M?AF2T,TD*J0DS21)%!=(Z6:,S$S!)]:F5I/+M?YQN"4;7J^:#;>HLF$4#6?# +MJL5ZLM\,4S0U0AWS':^3FNKJ8AJ)\/JJ90CI2$BC*X(&TW!3( +MX+)K2KG$+[D)JZ<##_`*9YF#)[C-45*L\]?5DZ;%/(Z2N)T +MT`&!71#:7\"C$FM5A/M;<=U,L6DJ.V\,WS>&Y[.A/W!UQ5E3,<3Q*#L%P4RI +M'JDUQE`?]SM:Y5)-57M0N]9@-!C5#J?#[PL$_5Z]<*NWN[%378KU.EHJ_O1V +M/T@XU2@8\/N$"[((0)#LM]2T3;[%[WGK8GSSKG9_J?'2LQ] +M7K5R:ZW;:*0F)\D2S4I[:VMM:XD-A\O;CPD=1- +M[44VY$:K4#,:XUF94JXLJI(K%'*E7%;N4A35-2D-&IF&IIMES;9E&?P97]AH +ML]GE,K3"5BW>NFW!PB*%K,YFSN!/)UA7_2J@O*SNB90:JHF5F?D8U.P/YC,[,/XJ&'S^:AX2&#G-W80QA81#.$,?5T=FP<`\I +M-AI87(J]-<%`T(OMN`C;;9!"(;N$W09I1UZD\?L<=ANAUQE@X_36&/*0R'>Z +M<1XBGG?J=0YCLJIWAR^T[1W,"?2FRF>GK'G6@]E5`Q&IM.M=*R[8P]1-)K/%Q!T1W6GVJ/1!H)&J#6URJ@QT@XGH>ZX-WA5>SY^R+WI +M0?'`CV?(#DR?[[(.'OI+[GQN_G+NW5%K[15L@59%]"<`_JP&?W1H+;^\@,!* +M%2V%/RE3TDJI2BV%.C<6Z];(KBK->H/H4\N619\>9[_IDS&$5*)+J!T18OD[ +M`\&`6N4DG$:,F5J]/;'AI:ZWVS.HCJS;]M?C5X3_CG;G9OB/?66.Q'OS^ +MNW@G9J]C/&K=EL[].W<%?'LG]SZ>1?>0%GQS_%&"28(A"5*J($A&=9J6Z<&S +M7TJQU*6=4IAU^BEK?]ZS[.&9`Z:\7_A7_A-]#:2(0>O +MI2IE,@589RH)LUQQV]K_ND=ES:T,AQ#?4>DT`:.*Y1S+UD +MX1\$![DG480W(9+UZ4?5[B$J8(&_ORM7NIO;.]8FZ/P(=Y50',J#G>'.?;DA'.'0! +M'2'/=C$/;.1_NN@'=MT#Z(>_F]9VZ:`_YM4*.4E(&#W%T'(3Q$:0&>R9E,L5 +M9J/I%NX''R[@=I1?ZV&1SX<:CD)J6Y[,S.,G+A>\^YYV9-"K=;`86OV09K4P +M0:6TO]Q+=.'6[_V7Z3(!;N*ZP_B^?;O2:BVM5K*MW=7J6AVK8RW)MBP+$X'E +M"\SAX`R8A$,%2N@D=MS$8'!H.$(=21.&TJC0UM!DB):^E8T3C?3>/ATCZ?>^__?_7O[2ZNE\R#[;#YXV +MDO-(P[V9+1'"X=)5SX=[RBN=K.,=K2]TWK\)^\FEB#6/)8"2.?B2?M"YP[5# +M>E79&=T=VY$XX'I+>3UZ(/'?J(F,VJ*X0DPB)NHF5DRL;-!-Y:8$FRJF5LZ' +M6>(IXDGR.6*%<95II6T%MY+O#@P0/R4W),REA:G(NL]-%NTK +M,YD[O"?P#BR\+XRC\$UEBI*E'8[C5,>I.$`I7'\T616_-)+-C2`+U$:L-E>; +MLW"C)5-1WK`Z4QF).26VQ$!C@(Y220Q3\"0H=I4F,8O'G`2&6%$2`Q$TE#BM +M2BC!4<$Q^6("E,S45W! +M1)&YXJM6K3TS]^$MG1W^R2M[%CZ[987Z>?GTOQS9_XW'[U^*_^\4BR +MU_O\XLZ^S=6'6C?_$DZ.MG0NVM@]^P?[I]*UB[M?'/[UBI799-.Z=];__-S0 +M*^N7U#ZF>0N.3;I_&1Y!^\A@"G8RTWJ=OR[\(Q!3'7&>/V./H$_L<@^Q. +M<8?C(/O[\(?A:^RU,!.C!)X70AX((%DD!'CM@@K,6L0`9AK#4_L4DC>1_9@% +M6!#K8]&B_I#&.%J&&!<`(S_*65&KSO(YQ!=998&SYI=:_2/:7CFB8TTRPFG0 +MF.K-9!(8@TP2H\-4$NA8-(RQW;`!RR*RU2G-+_!1D@F[UH#&[0V]E-(6!9C6 +M!-[P,DWH!OI^N+KKE=.WEW>N/]OY.OU$TYH9[>M9W_3'JY2#%W,G\4DS[?2& +MT&5`_/;HMJ^AK.[_=)=ZX;F?-05+0[Q8,779-W/L$TJ-_W[C"B@I<#QP_Q;8 +M#`^C>N"P9,:!1RB])<(5"9HS1YBB"$DR`B^DV]3*^YEQUP#W@&X2"QW;2=V6[>S@ZZ!SW^1E,C@^O1D0UU?!O`>1X] +M!`$0(GQ#QXIFD\B$:`E]@=EC$W`>8AP#G@64P4/I=&56]$8#38>MZ),Z`=IH +M`R61#!!LM([@/8#"\#*.'P9M&:,A(QDHZ#$SD/+5&7`:8\!Y#(!F]'<@;L"\ +M\1&[D,_SFJ.ED;VF[9K'Y=.6&DT]#R34Q\04$CDNFOG"A:+%%G3GM3F.Y4"< +MO:.-Z*%=]+'DVG/I/C:M9]-H8E`>1D4*B@!`WIA"KNT"8SY9)<>!-!8.2P'< +MEKNI+ITU:S%X.P34Q*3F_/_F5Y58V_(W6MT1>S,(X@Q>E;^4_T_`\*//8>Y> +M3W>*#@0H+FJ>&3G_P3Q[58E1%T";A?;-AX+?NRC/&[$`5HE=SK1N$C>Z\`FP +M&2X0'W$=!Q?`)^!3Y4MP0Z%C%"N9Q$#4;Y'$TJC/&0P;6"/EK"`MP6CEC(KV +MOY'@(Q*09*`T&D,R,L;\_@`5'@:)C%5X#)^3\3SO.>6!GJIR0]C"#N/P:%4" +M%:5V%/AXU/?2;*XVG4.HXMFN_!>6T=!G'F)E$D^CL>`(GOE,B[< +M!C`?W@8B?+0-`,G8AGW/];3B+!B>+X)B-RI-\_]G*M_./XZ<:7]@Y^ZV,Z^ST +MGQP^M`ZH>-(=T->N@%N[ZG3RGO=>GJ$XO'NWWIX?QV^YTZ^=R/AL%6HEU.HT +MHFP<*>K692A1TNN'05W&BQ;X?MFF +M-Z-PA%CZH#4F&OQ^MW[)7NX4]Q$'N6%<=TPVSW$/X^11.5`P.#7[!<*GM1`$ +M%,&;U#`U;!\2OZ'(:LHJF45_R%\LB5S( +M9RW&Z1C/\_E0E)YSR@$<",R0;&+"Q59-9@4TFLS4[`.1L1J<,4F%!"\T +MN)QNI\V#AVG6M?E?BWJW5QIINN/69#"4O/*`^NEO]:E':/5'3#H?J]")B$L+"V(>9 +MCF7!5<&-0,!'2YPE +M#!3\L9`Y1I44ESE=KE"80D(,AZ'`=QMFT-V8W"KC +M\C!.#RE6=YB`&DPE,@;S;G9D9"1=$%NM-FG/Y=A5>YI4U9>GWO,_O>9[?*>/7EO[J7(/P7`4/,>Q$ +M?ODWPMB'(98]#F-$XF5-KH))1,08A'$*/YG&8S*,)_^Q]6>91XAM58!>[A<24P#ERW-LBIDGFAY^9CD*=2J#9;$/\OQ='&BT +M_#POOAX-27Q8DQ\5*BK?5!6JC"*'"#=$(5Z7SF:@6,5MU"HY%$S$LED]=D2^ +M(>,9>:'\@4S(IW'RG>;Z01WI5G-3+9B5$(F@I[*?5]4+`0.Q8#NY,21:`&[& +MD8S5NE;0T@Y70DFI+@V)5QJ)5Q*)5^/7Q>N;I*MM&D@?[%(XCI!3,B83Z^^Z +M&A5'BLW,*>PX/V+<`LD[RII4;ZQ0QIDG0DGCR*^,F]<_&[X$>B4H9M$&X\E# +MO3\T;ADGC%'CO+,^*$=!S]99E*I:O`UKC/6Q[:<^!%U`_/AO)N^0MAV&O-.A +MLBWKYKOCN$/B;1I"UJ=%Y3X^HD41]?1)ZK$2[]5D3N)%358E/@E7F2-(10^Q +M#I*DZYV-,441?5X;C>O)B$BS^T,CVB/PP,CADA[93P]N-;I)VW,0F([R?'P]E+:.J?OX;HB-!_-B2_,: +M`B8517+F29E@I&2GQ+OAZB`)TH,J]KAIKQ\6F[),SB!^3*H7-A/ +M[-T,:K(<8M)`M;S'BC.+`-)07]\0O@*ME6,@H]@ZME7]7+7.+4^4MW78%%,X +M`$Q)F.4DW#/^BZ?.SP_6+PDO%E\2 +M]ZFO\J^*)\0SXA7A%NX+8[Q7PA?B*.)T>2_U/L)?ZL])W0D6],DG?"$ +M/0DEW!KNYPMARIJP)GWPPI>TO-4"DHE$PAW6^;#`.IV-;CTIX+H`S_!&3R;" +M`L\Z:0IC?$&"XOTT+FJ"G0*-NC>38.J"KXRE"NL!5?L+W[W/8_]1;PX.KR&F,G +M^'3/RE)E?S$73QJ[NJ!NG5.8KA\1VS;.A?RQSM]@?/=H^9-9"4Z5F%FKC1]7 +M*@=Z[+)"^"*N[C0X.=O8OZF3429U_@I\+PXKYSO7AK:$7@H="AT/#8>LT_3B +M)GLM%/`33L+O)1UT\)0WS4&&<306;`@N"A)!!)A@4@P!)O!34HX,<``Y'_0[ +MI.!F,WW=W":I)H*6!M/.3#?#"^6!0#S0T@UNN;!V]/FI5J_]?2$%HU; +M"'SY&>.74YYEO0=K4:`JK[LK04!M=JL0L@>$A+W#WBTL%IX1KMKLC(VQVQO= +M/"\P-EO"+8IAD6<(C')0?)T=EH3)`<++^X5P3+'XZ+P@A7U:G>;R:UQ,B]": +MHA'P!\*"A8OP7()U(2V)BY'&:MUQ=;)NL\.@0(^-L6/0^+[UHONJ]RI'_-%]VWN;(ZXY1]@1_[4@><=Y +MB[WEOQ,D"S2=%NH)/!VP"0)O&5SI`1Z8*]\[;'_=CML'>61>8AB95^FKTOA4 +MZ#;-J1GC0HI/=:@N!03M[1CAM\`TZ80[BH4[C(.1DO3"A:FCVX'53;>;?@4F +M1?A%4((@E3!W2S-R+#F*NW#H30T!OXNEK!+R*@`4X\PP`,;$VZ&?DK0N7P$S\ +M`F9Z/=1<@RV?Y13S!HV9)6*.U!)[0IIIEW-1C%L7$K1EH +MY^.N:EK4:[XNAL)V!X;7*4"UAYU%@(?@XA"8(H9Q1'':V5_$>@=WY&VV"/44 +M1E,-$F!S;$Y'W,)J@QSL-9C/9X#I7`Z'/E*.JG*5;,368TOVS`FW1]F7GSPX +M\<:667,WX`(@@=>X?E=Z)M2SLW*!/-BMAO3*/RRXUGMYXMOVGMW$MF?GV]2K +MQ_]PEC!^OCF'`A..%1^.$N.06VU8.\CD59>\@]EIWV??5_?WV*A"]=/+F**" +MVQE*V +M37$P)!E)MWL(,IVVY5OY&:?!NGP]QK#&QH/W@]SX +M_?&,&=JA>K'PP-6F1]C:7.=8"66NJ4UYD_E(K0TIBSOFC!8Q6X(J`DL*+@UN +M>)3KE2(64YP..LD404*S,=9&LHA)KD@18##/HC>J/M1D/O/X`RBAS6B%P@)@ +M1IO1VM;2/)G98*J%+PG%(`+@UWQ>*WJ]J)62"?"3UN[GAU +MO]]Q8@<[<5X$2*D8Y5G($&.C"]4$H2@!*AB;!AE-BZ@86XNZ16@\"E.5#J+A +MCG:J*HJJ@:JU:U'%D"9U+.K6Y8]506L'=G;N=7ATVFSYG'N/KBWY]_T]/M_. +M[=]=NV[WR4^6)%QP6G.]V6_=N#9JN#8X<+S:J7]/(Z(I.(5P;4TBM`EN0L@' +M?0A9EXG&9`L9$`W)H/T]IX@XNQ7H(4E:C7I["@)D-)`N7`\7T""L0;)J(LBH +MS6?=9)VT3EFU5GQT`0QR;R`*\&ELJ89PG_[MHR1"8MJ( +M-J:?Z&?6",/BL&?8>\YSSFO`,Q-$6KBM&,]:3%L5,`L$1"D2#'`FK5:6[#:` +MJ)2;DF4_;S(F>$X9)!&M+NH/*#TA$O[:(%GHG_C59%&%)^`0;,X&)45P*3\Z +M2YMM<.$(;1Y=G%CYU[MK,BMVP)MC2[MW-UYO3._N[M^%\.R7R:Z1^LC))T^] +M^LTKB#V[FI%EX_J3]<\_&OO3)[M^AP[LZ*)D56]J_C-B%XY%$;Y1_5F&@A9@ +M@0Z7'_AAA&['M5VDB[GUA:=-E^V7)(NR5>EJW*+^LM68-,2+D)`1`9F,MDD'4\DDS&:IM+X+I5B\JV% +M0@Z*8)2TB=:W7+(HG8V914N$"8JA4;%=+$8*U80D)$"N-C]VD\(O.4.P(;O_RR$Q50N$Q@E3&6RK-Z,-[%B1!F: +M4'5TN""@/8S;R7V+AP\HJ,+H@S-"0VB"80T,,A#A,SA?$5(,`R,W-XMM_FX4 +M6NY)D188@E"7DB/9&9R!)ZG=Z$[$3.J6'UK)WS +M<%Z7[,HZ\^%05(YF2W(Q9]5H/0X/RR*'(`FR;-<*NIR0S>HE3\Z3SX<8CU]# +MBM0B3/M`K.0DAU8;4U>J8I?EJ`T_&/\Y-L`^L>;[L/J7 +M8V-;T+;U8M1!VS[^6][&),0!.+,R.3#<^",\W+7J&_63:_LW?O!%@0VT^I8U +M0A*U^!7X'%SZ\;!6EC64,>$..X3&=2A4)*WU9/F%C=(J/36(]?X'UC(`H.%]=&B-+9+_0']`><1Z1$$F0%)6P +M<3Q'$D34%@H%0_B$TX6#_$"0#_G"T&+7A,6H%2"?6_20'&4C>2(4C$3COT4T +ML,&OJM1`U!/AH]Y(\$WX%1@`$3P[8NFYT3E^MCY;&JWS,\N5B8[G.5Y`5UW1 +M1K5O)6S?1J_PBAPJCFL?4CEV;Y"5%PI%">;#$#\Z7Z`J!]JV9(F!A7A@VYBT +MNP^^W9E];%/C@^6'ZDAMS$SM6H)I2&T+<&/8W2O!]CTPE3$KP-"V%HXU< +M8V1L$2%)9.\A^&UX^-HS6J40-&!P_I^:PYIIS.A5T(UK8>O?Y;LR(L*+]<@0 +M/$&?*)VCSS&O&M^D?D]=2U_+W*)N96YF_T'-9LQKR40VQKE]#A_(F\W0O#27 +M:BME$V8:Z!VD(R\1JQ2PGZO?QL1:GL&!JY=OXP&%)Q1^*^%3\76(G[VN!%5I6BH7 +M+>KL"D8,'"209)3ULDV&)OS7B$ZM%[`AS@N&$XHC$`&4)@,NNZ2"^P +MAAW>!W@$542Z;P04T!V"(T/W$UM!I5![FZ3H$VQ1&QN+9R'F(A6<,"0UIV5; +MNR(=/@XWMP)$@\\,'BV',SU[&N#%C=#N:'DZGTK1$NM)9EX[^TZ_1!JCG%?R +M2\6.OHKFL;8-*]?LA_M03$ZM']D0=R\K/;VY_-3JK9%>04P;2F31:5P46OSR +M_OX?-;9W.,,FL37LDM=5>OQM>X;0;--;$/.SFK=TNP"/Z>*%:NR.`>H-\(01 +M!DEXDUT!W/!H4"\1P8"H9QD-"'0RA+C%RGC[3#6$JG18"NO3CK=9R-;@?--W +M8C;"BLP"50"#^[,WH-W5`EXM]]@\1N\,G1;\.(S!F3H,8LXP53KL!!. +M.T[F/(X5;B:8-ED'4$*$62((FC#:=!#$SM\02&C=N/O8'QI?W-I^P]\!J>=: +MGQ_?_\+`C[5?M@A5O;X^F8D/?GGUH\:'ZQ+:0$?V[N;DA\>/U]?V-E`S!FD< +M@T'-%&@!07"NNG2".T5>L=ZPWN`_MMD +M(B3'$[2%XQ''VPG:J#/FL=C'L`/M=C-!U!/T\3A$%R5+GT_)5BFD9.M_F*[^ +M("?J.[K?WTD1L?+P9*9\=A&Q<2VB0C]`JH13.U0S;*N17,W@:@++N9ILRB!I`=WU +MN[@L=!)$"\=GMSU_["=W#\:+;*&R\X6?7P;Z/\>PU_;,YPMR7.YT,N__\NG+ +MLZ0EU`.S]UW[^!QHU[!)0FPF=:-P7Q:12]5-SX1_%?YK^&SLG[$K,3VR*?Y0 +M?'_\N?C1Z*OQMZ*_CW\0G8C_*?]I]%+\;WDK%IT7006CY2*^T,Q:QB@?YUKH +M97WC?"HI)W`7'I!2"<&%Z3)%G.Z@0";=82AV2Q)O">`)6JJZ``RCR!NEW*R# +M[:!=@;#4I=`+8CA\I5Y"E((ZS3!704TEK@)"JBQK7C2R=1;"L*,\BV56$;`@V)4CEEZ%1,#>)H@"$6*`!G2HP!%N3Z+TZ+?_[PA'QD8.?)Q_GX.X-W_P&6XD=0>RP]7B13ZK#&XP;B?OH>YD'#3N-NXC=U"/T;L=N +M9LIZS=:RQ'B7<80Z@[]/7\"_-GUI,Y:-)K/+C9G,J,F,Z6%QQ``V!].S[!JO +MW3"N?TF/ZGM:+%XW#$E>\IP9F!7V^K%+I`*]WZ>Q=Y@NP":J\7>RN5_KTPJ' +M1Y/$[=8V1,?`D..@U8W:AKA]H-6MLV(BXJ18^#^`)]RF5[\"_`S3^U25OL)L +MW@<4W&%8:R*NF!RO$#V'KKY0?\S\[MX-8V4A\L7+;W_PW:E72YP5'+:T);=W +M8$?^^-MO+FQ>1SSR=\">/`N"`^NRB]8FEP_`#!>&!D9"+HO(_=5D&8$S<;#&VM'CT8775J^7PYXV[V450S,:[/=N%[>4_\WJ^N[ +M#]U;.[CIH]E=?$:(>1COW'#/9*W^\-:*B86:Q9%LHQ=[#^XS.]*/+$66(1]6 +M5PWT]M?V]_ZP=J1-IPOKNQDO#\6]>!.,="&BO/( +MGI0)WF.1I:9!V%#0I>E^?V1!Y%0$B\Q9D%[FX5H-:'?!NFR9Z)PW."8>$E%1 +M,6AB2)?.`\0=&'7@H)DMK[JJ\ +MZ0*,X'1I\$H!S9,YY1[7/+@"NX1RS:DY==JCT]C9=W8=_O#VS%.A10'G:C>1 +MD*5U;QT9^/4@L\1.'*/-U#N'6GN\=\Z.YP&XX^G&"Z__XG1Z;B\1=X7[MEX- +ME59M71VRCZXT-OY3W7Y[#38*@*'`JJM4LZCT[,B.\WW88+N_F-EVRK3:S]G, +MWL1S!]]^;"#8-ZN+H"E_.#2TUN&3[[_SN^%D_Z[WT+F0KS3DZ[^@-\O(&U5G +MGQ-<=P&3R^-"/48RX9=1H<+Z3X`;U:Z`PE^9"WHJK(\3HA4VP0G3:SDG&2<:&2-V,04[`MA`4$JT>9<6F2"F:P#'EZZ224.>J@9?4%0LKPZT5 +M^[V)*ZD'?@95ZF1(=+I%9Q`F?'?()?F`&HZ:6U6E>W.I=H,*<&EFKB:@6W&U +M:>3J`WI1VINW,"VQ/:TC:"6Y_*Z7NKCDO,:"9:F>%3\8SRQIS&$M79NQT_E. +M#`VVA(P^0_W9_D#IB?X=C;LW5LTL2Q0W@P.K'MA"->Q;\@2K>1C4/6J%.%I@ +MQAFNB@)AJQ!LB`L*'.?FR(4NUCW.9--MC"IZ&M]K!'-K6IX=-GNLOKV!F7NW`$^ZVF-X%:_M>`E#,9Z +M:EO1J,UT\T>-*CBNSA1']E7%F)'EF(5M+#O.$RV6!"/P\498&88W6->$K5&' +M,H@,9WI=""8-)<5%W=,X='M2R2[9SAJ16@`'`K"'\QC<)':\2*LP4`3\+: +MX5[B7]-1PF,+O[QM>SP(P>B.*C^Z_M^'!V+K0T^AX[-ZS`8_:Q8H1F^<6GML +MU6]**3X-M8)#K=S4;47RR/GJZ.S@FZC_#/&S`<"!=H1$!B'$*@&%M-\TL$D949V)).R$.!A8A=]FH1LB`\"JT>R +M$4QD\SG)S"3A>\PKR*B4\HY(CTJG)4PJYA0M6AS)1)ZS7#P-S4$15+&@9):O +MOH+=A+PP?$:-*B[8\!)N1"M\2O.[,CE%:4_A54K=LHW,#"9! +MG*F0T@#5`F@%-N""`H2"RFD/@=(PX#T^4I8[["RU8GU_S*#'`.-C.HK@Q2U/ +M_*'KY)-C@XV:0+%F4^,O:=]`@V<-J<78MW-$%&7=;6Z;SC3UYI4VCG`1&,L: +MYA[/7CZQT^!A44!8+78"/--XL@_:LP]B'U+U]1#B0FZK<@R"U1#6Q06='$U< +MQ(L6EABC*1S#X8]=3G.KPD&*3F"XHBBWQD%%3A"`^3.EE)LIGVPN-2V>]N%> +MBZ-LY5L??]>`E58V_D]WU<8V<=[Q>^[%9Y_?SCX[/I\O]IWM\]GQ6^SS2^S8 +MR1$[3@))".4E"F`0@[ZP@DHFEHU-;)6VE:X?!F,J+51:0=IH5[15=&N!?9BB +M-2I,RBJ0REX0ZS8-MDY=U`^C?!B-V7-G)PRV?7G\W%F6_/R>W__WPO.FTD;L +MVI"WQV`0PQ6+Z]Z&:86$4P(0$4$,.>QU9!+YE\H7O#D!=0BOV=#UL?45E.ZG +M)P*3V&`Q6>-COP#W8/A78=OCD0J\Q?$@7D;X22$<+O-1(503Z&CR(AA1K0VU4$RO.:I>5=%1%;ZYT,`9>2Q-Z*BL3^L:/'=G +MKLE">%8W?]45N:)%C`E:&U?GJC`[5V:VW4D=*=!L9GJU,/7H%$+N=`/M`Q+D +M?ZEQN[.2C[Y:>2-.YIE%B;PHD0:ZU3MB-;AQN1->O"`]]8 +M>[JU:T0Q>L)VU06,,B'0VH*3%09&0!GE1"&ID5(0P7^8%(02[ +M3U:[PC8K[:FDQ#,X1BI.>VS`(]M))2L*5([,1:1T#O?Q\.8N%)QR*HUAN#;, +MA;SFCK1NC\[2<@6&%MTB[T#A=*PX@08_T<3;YBA'62[*1F#@Y61O[($Y-F);<]-;JKW[2O76YO'RNJ6_FJPH`ZW +MUH&;O"F_';*8@Y,@9$0\7<\N7W`/[9E?G673!3WG/FZ(%#IXY+Z$N`:7WVN\NM&X"[#KZ?V_;' +MMUJ+[[_V8Y"M:!PRZ1GY/&*!+%I09PJF@GC">U)Z0_JA?$O^5#92$B&OE;"S +M83`L)4WY-._5";2:=E=GN=U@PU&, +MQ*)$!)!AN.`R&D$,DC$".@56:Z^SS7`[$[?#%'C8,%;)U:4#"'-SAU"[GFSL +M._GJWK5?:?URAR(I9L:YDU@@B*'LUITO7/[D[;Z86AAZIN4X6/OM_,5WMB5: +MIN5SAOH8-C\>A^TU`.HFPY$AH>_CQ2NMG]O,H7;FRD!\/X(=A(;I +M]9JZF8IS\6(<>S'QH]2EU&+J]^A'J;L)DB7I@1ZS*-@,LI3F5!_PZ>'56G\U"9(:[?3PJM%. +MP_:_@'4H8*51='"-QM,DXX1`VN/6"&).P\7D,/@!X[(EZ`AB25$0<8;R:RP$ +M>CV-KP3;<.$_YE?K#DZHIA!H/W!WG%>?7D,G["`*BFP(];K8Y.'O'/GVU[;E +M0B//F*!Z,MT;6_S,=$/9M/?P50!^_33-<-$B.+L^,?7Q2^=O8'7&$AW"`8Z; +M[ZEY3C;R(BCO`8>'_9F__>E]D-8\S@3!/@]QCB'/J^,+?E`,@D`,:*H7@_95 +MT^S++."#,,<+W;3L(:%9/;)S'U2ZJB9J3(1%?HB:EFBQ&-F2GP[N[-!"ZZ>DP, +M2]$_F-E33<7Z&K.55G5+#17;7'OJ_A+Z*SC+&20+,%5D$`9TH3%KR?J49:_U +MD/F0Y7D+%3/V\IEK4/[@;RZ"[_X4[J$3BZH]V,/RWFNJCQ>Y`#R]]AU\=&O? +MQ46G%:&,\!];*9P(*%DG22@]YJR=`Y]P]SF4:QC79)%>&`(^A$R2O@1D0[X`=(1`\U<&*7+ +MTU&#-$@!+6QGM>>BPH0B'J!C4,]DY(Z]-RV`\>BE+GU]UV% +M/5O*VT='#IZ:.Q%U6+!+D)M>>"_]^!D8K:;5'I,#^(*H"RWY@P;5+%(CY(#= +MK%*B.:SZ122(IET^5G4D7+"6+M[DKG`WJPLLO;RP"+?T;^""#"[/?<"Q5[C! +MQ>4*1`XF8T@V=PASZ6D@;T*0M[PCI1X8LU(F'FA91*]L(YX-<5^Y@8:[' +MLY\@3.QP==9*8*=&E^?'Y>&@U.5OE/>6'D=W8`:",KM*(R_CUKL:MYSWE[#K +MT!?C2`)Y79U<1ZX+;"6W!O:3^P.'R%?(5P*F@#5@0[N-5)FW":%(F8\+(1=L +ME0SO.N;EO9%NFC(1<1MB@#XY()H3)"]3:7LB(=%V&@K8VRD$I*6(Y@NII!8O +M8-Z[JYTO36LBIFE8I0)EJ_20)3B#813'(G@0YN]0&`U!%K0E"KH![`MZ_-<+ +MF$-O"/JTV0`,$L%(%>BJI`$%Y4O.2Z#*2+OK:Z1(92NH9=;_F_=JBXWC*L/G +MS,S.;6^SLSL[>YG9RZQWU^N=O=KKV5UOVHUKU:Y+TC1NL0,U)4!QBDA:)^"T +MB`>K0CBJJJKJ0Y*^5!C1/M"7JDI-*E4E`M>@!*$(1`B5"RJ*($`%4B4N5;T[ +M_&/'`02,XA_]"O]A9 +MG\E]HA`VJ9$#94>RTYX9IS6O-R`8`KMY?[9UQ[[G*.Y0U,=I+N*3TL#957H3 +MI=!+[<]DG5G%@&K/,<+0D.&!R]\AD1ID6\1?<0Y(K/C6H"$)%@9N +MP(FK47)L]D@A.16'R8*"7"I#>O#%B;S@O'K!K::#&:Q5\KGN;WA1$#U\]Z?I +ML7"9WHRS`4/2M/B"40T;..!W8"`A9"I)+QJ(LVF+8:BU2 +M+C?D0CFJ1;5:)*"`I#P/>2Q![()*23ML]J[#P`M.(E'N.D/0D&KB1T8P"E?UV40&9Z9*.ZM`,"'S76EW>:VSVL=K>\M]=(V<%*U_([S%2=O;>6F;(ZQO +M0W(+"2Y!P/\J6;$?5P#H'A\*D,G2_08<65\7A1RP46R!6:^+OMAJNIU;K[FT +MHMD-)_3N)89E7=1ONQ]2G,-%=7]1293PR6(E%TJ?O$#E`X'Q(MZDG^(B6:40 +MZZ;Q:]JGU72$U75'9G;O3P+/,E2I\W,'!^U[3^8Y$#&/Y +M0HH9Z`BA#OB&=DV959K)FI6HBSXHU5N5%L194E!P+G\:J.64T9Z6@AGO2JHE6 +M2FG(8JXAU\#L+/L2N\5>8QFU)*=8N*V49=5R*5416;[:Q%Z9;FJ2;XI&K%ZJ +MTA%-*U?HJ&BQHL),^7SW3!';*1\;K9`0:E^E5=K9W5DF.I762CWUT)UJ:T]M +M]6O242QRCKR47X86&J)=3SYIF^<`@']<7OA:YCQ]3L/^F'^I>-?]Q?E@1*8UC2EE_]Y]_&"1TC2*"LG^ +M_0DK^EGCHT),]+LX37,:=^`%G%I,*W;IJ^`CR]!K/KM]HE/A3$GJJ'1 +ML9PY+\Q$Y\U/1H^99\0SYGGS#?.7IF?.Q-F\:.9A]SN=#3D$X:D@+,BFF3<% +M9R@,8WPI35M::``N*G. +M]IW_N7&(GP*VAWO%GU18D@#]:[N4\,<=UO"XEPGO9->D-?QR-504W7]\DW:/ +M:''LS^6\W;3K8B1$ +M4?&XHYC;>^OZ#^K[1LY*O\7/0' +M_><#F<#[RC-!%+RAGE$_"'TM7`]_(_)X-!)]7IO6_J8_$9N)O1QOQZ\F+B3/ +M&W74C_QPKPU`_@H(1^!FT6T+>8FB$6(<"+&(XTD,38KH=/6!V^.5?+(_`%M9 +M#:$P3!O5=!2+)P83)(W42#J3'8!;0"%&6$:`G!&NLCRGD00<'F`:+AP:8`;P^P"S@[^P_='#FONG\ +M`X\>?^14X?!CQX^>^&]Z@(-#,/\,\#`-4=\#Z%%T'#V"3J'#4*^@KZ(OHZ/H +MY"VM"F#W&."CZ-8S_:\V?7:::!6^\2PB#$AP51#B;K+?ASX\U.-LY,KW'O:V +M_HI]?._YAY5[OS1L[:>[;>XKCJOP*`SM_RG``-C7P^\-#65N9'-TF2[";8@(9' +M["[RV,W+$(@$S:0\"I,1*';!C+8B5EJMM$,1B=Q06C>C=%)E2D'Q@8[C,"HX +M1LL`\36(6LG>?G<34G`Z#G\XO2=GS_D]SN]\O^]WSMT-!(!DM$*!M[HQW#3Q +MC/Y+(._G@%A9W=*LOY6P]N_T>`70BNN:[FX\OOJ6=4""D[WY[I5KZRH.!]8` +M-P6`U,OUM>&:\VM/[P;&A;AF'\ADF7N-]"RF,;PVN:$L.)+W"]E[)^3[BQ=L>.SS\#/(G$4]BTZKYFZR(M +M<)^U[4WWUC;YOOAH">-1ZZC2FHFR".E:)88IC4@'K%/L]+4^CRVR8EH!/+%] +MU@=*)E?_OK_W/2[LPR-X$6NP@?/[$<58Y**4K.S%7`31+;P8#XE=V$J_2TA# +M&5:(,]SC&=3C5?IEPX^=2*6^!BUQ&V]9 +M)YF7`S?$,4ZGYSSNU"&2Q"CA%5N0@!0XB6<\*KC3G5QQ2"3*,NM>KAJ&`G@Q +M"[,1(.[UV(['B>PEG!)+9;/2;OFLP]9K=JVX/HM3^DKH2$+H[EF!LH9=PGN1AOC1IGQ.SC%UHV/1;*8)F:) +M"K%%/":.BC>E7_$H6Y6#JE,;;7V-3#)S,[/))>I"3"/NQ5B&,'=^$']$.S&> +MPR61)L:(`N$33\DL>8NLDZOD$?FIJJC;U&[K7!R)9"4<9'(2D<_$'+9*\O8S +M1(CH(?R:M7N4R/:B"R^S,J?1@V]P66C"(1+%6)'/Z+<1WSOB?9DB4Z4AB^5I +M)4^9J:Q2WU"[-7^L+?:%%;""UFKK>6;_/O>R,[=YN@M+B;B&N;>PVAM9.[MM +M8GL`3V(/GN8).X"_<>=_?@=K8*GK0EJ$(UZK""M5E#-G>2SUW, +M\&GL9YV>XUDZSNS>8-7?P\?,["M\BU[$!(1*GD?R/.>*B)A9OF4."`ZQ$OBG+@H+K&\FDR60Z4NW:Q,F:QD +M"_,<-,KUT;Q,F)Y@.PS'?<;_C`<=.1SN>P#_P&]ZTJY_#&([K?7;A +M67E"^G$&Y\G`)EG$NS-!/(L*=1&.\.V3*?\M'Q7'>;+*42T.()7O.JF5(XL] +M3=G)>PWK0_8>]G.Q8KX':8L=MMY61C%Z@_6VULH:1GCC;^2-.(&S:I*XG>^/ +M94H!SV\-WRSCX[/\[CSW-.]ACC1RY]]*BLS(STD6DC4H?? +M-.S&HWS]`YX"J<^'=,];MUOZ.8)GZ%'Q:)Y`R)S^?&YVI.7!A,P>7B"MV?5N_331'2_69I2WW$'_(Q7N>,]D_.W^!QHW-H +MZHSV079D$R7A#?5I'&P/OYEN^/SF2,,7MRG9_G"-63$OX/=EN%Q!C]L4)=5& +ME0FCV!R2U[\\'METE)@))0RM+[<3P#:]P]T5V1YUHBJ4EUQCU(07!TPE'+2W +M&)IGCC!\YHAUW6G_%:_,_-O[C1_1:,KLTG!MI)34;)O=)X9L*;R=4OD"G3'E +MEF#`%%L86+?AVM#[DJ@U_+8FU*";24:Q41]I")'S](B)^6M=!]/3O9T6O]S\ +M>F1AP'"9MV88P;`OL^,F1.:O_?-(KS[R6HO'W9FV<9J+E'5Z9GEFV>,T5]K& +MOO%?F_KT)[L&Q?V.G.%8/G^`-6$#,6YC%J9>K1-`P&`J1?9';1$BU45TXQ,4 +M)&&YF502BCBGVIQJV4Y#CWP)EM'HN7"M)MRO2M3RS(1VLRX8I+'W6)F&$U.WL0PL#QD\C8=@_P0;;B;F#/P-<:8. +M\]=/-47J]YAKX_8H)KK+HTBJ"'0(T1:,"FM+%+ZL3B1!6;:4YA_;QWVYC_E3 +M*'!3D>OB;));+R7OI60[J$?TR&TU$;U4K^>!5K/C(PVUD6`^4U\06,[/A0&7 +MZ0UF#$QK@\&IC#/9CJ/&XT2"C-#0'Z$A'H$!>NE4Z"YGD7,J`O,"9JLOP_3Z +M@BPJ[T<7:>WB.0@&Z54T@)3CAN5I_9BG$'-1+B=3^Z(L8`R&"$8B?1)/85ZV%XUG4Q7/R_&2XAYF*;8=__CV'_50S;)SP! +M,?L?D0]Z=_?N3DQ/A,R^YOMQF/JAU2/M'R;[L$\[:O6H_+93@='L8Y4',8WC +M*(Y>.27VFG84(RAGLT]F]RA9*&!WR2F82[F2%[:3YSP[\0<.SGTF<>S8(5_^(FX2O]AQ0D+3>9!1`DM+ +M02MIRPI-M?#1P&A+`DU89ZU=)W7--JFCZF#I@F'H1=#"MFR--$(WJ>O^V1BJ +M4JFKYDV:H)H&"3OOVA5LVOZH-%OG_,Z]YW?/O>_<^^Z[MY6JY&4E")CELP*9 +M[IWI)3,C,U-D>F1ZBLS0F3B9IM-Q,B//9,BT/)TA*LF>C8>I3253N1Y:H9)) +M@'*5O`!@5&Q7>'Q5\.B^_@8;@@B=C-M%ZIZ!<7^\79?G&R7VSK%UOZ +MQ4"_%NKO<)$0\1+3'J:K%$>?^&F?^+L^\;=]XDR?N+-/#/>)WCY1Q;]7+./B +M'\?%'XV+M>-B];CH'H?:M\Z5;2A#Q@MP+MH``7Z3R]33B_@72(:GI/AG.?D" +M[5R%+Z,XIY7?*>(<+!(-SZ,4]@+^!`TP/(U\!JU^>RX3H2I^*)=I!_AR+K,5 +M8&LN\Q#`8"ZS`[IX$&58DX&?2DXK)?2:;XE>R;Q$?YU1"53_?`"J<_22#YJ?LNW2`]K74+T0Q#@H'^1/IEB?7^U +M`+O\T!J\C_J7Z`[Z+-WH8^V_(#/O_0.L[][X(NWQL_C=,`1\GJ;E19KTLXX5 +MRAR)0BE6"!LME$*416N>8I6-A2=9"X]8/\#&'H1A>I4R6D-'J">UBWZ)&JDQ +M>P$_#U>P+#ZLM`K9[PO9(T+V:2'[A)!]7,AN%K+KA>PZ(=L@9-<(V2JAPF`U +M2`:SH=1@,A@,O($S$'@O*M0[UQ4X^&)4P4L:\)RF.69+1-/:O@-;%,$&@OHZ +MG602&MGM=9S9)*,G9,*YA@Y6*P\ +M2":*U@397[3VDU%FP4M\5NL3,->'D/;AF<7?F.6/PU%D%K]8.0L'G1<'G7;[ +M:,*9L'986KN[_HO:7M3!NS_GYVX0O/>'-V0.7()E^E=(/<67F#YS7J!7!?IC +M@3$V;`)"EA&RC)#5"-FK0K9(<+IG7X']?_:4>W"V13/NN`G2M:Q!H6QD-=NT$T%!<`Z#A4XAJ-!C,*4;;6:#) +MI$.C930`&MF'9$:3R3Y&6])H9T;BZ:XS\3BC<&^C$489X=Z^AS+U[Y0I1IDJ +M4BH9Q><#2LJG43G8:T!T/W+;2C1 +M)BU#$51S4[7%8_&!E/-1]59@&^OKMSCA+#1;(;$?($JH"B>96S\44`#]0'ED0CY1>Z%6 +M5R/75O>(/?(6YY95C^%AY_"J,;Q?/R&6!KH#-HL[X+:O=KOM-I.1XR6_T622 +MK3:;G?=75;F)Y*^K"QATF;W>ZU[BK;<%_7:IS$9MQ&8+FNJ#C5?8?`P%VX+2 +M92Q],)37\I37Y)BY(7A(F@]:K(Y6)Y+R6+I5C`Q<=6!'6 +M5P8J;Y6(7=N(Y:5K#Z?6)O,KMU>V+W_8B?=>^M4ES+L\MVU5J\UPR.0KJA[6 +M3=;=9V_Q$4_XBVT;Q[Z[]^(R +M&DYQ(8-,0A=TC4E[I%>A15X2H5SRL#E4K520_M;0DTNUNX0%U([W)( +M?G]E'769*^M<@8!LY3B]U%[VGJ-'K.LIJ\25O94M(@FU&!3II`<.1>8]YF^: +M=>8(%_;K)8X+FR+A8D:+"7U_:/1]5_M?7$Y(:\+:.MHXY,Q+^>6E8G+GY['% +MVHI`(,VMK9HX/TMRNROO="'IYM"->W(/`5WM>0@GS0_!)#PU%&$I!U7(NPK9]SB#]D@-\:PL]0_3.GW57=5-(1&ET59DP<>FN;8GAQ`%NM&ZT +M<5_7"]RQM1-=;Z9*2T/F<&G$%7*%79'*KKKDNN2`_*C\1M4;\EQ(#:N1A=!" +M>"%27N*)Q61K*6 +M%Q_O[):[_2XI*8_(1)9[3#W=_[G8\Q9M1MI=5R#/B?R-_.@?P'8YP9POSH\V +M.PZDO0%8WV(Z3LYU@$N<%PDL7(%K$^V`E!$JZ0NEH"P0ZU/*V +M=DTG=:P;*J-3-:9N2CC +M@G>TGML8S]J9'9L_O':[M!_QWJ?H&7P+Y(4DZ/NRMQ!>&%X5_I;OB?!N[PO\ +M+M\1[DW?.$<1OIBOX$/#)B^Y'G2&:CDFJCUD46_R!B0CI+>*(7`UF9R,UPOI +MH4#>2DA"+26F:KP1$5,JC]<;(:.1!Y(84.9^\;9BE[=;*R/^*OR?WP[\%_X< +M'("?#L`#<-E-ZF$AUJ+,6;%4`@6\E[Q5F:?@2V"),O-H:?3P(A6N90E7HK8H +M$VLMN!J96-2Z;M.Z'9?.?[QJX4("GAC[3E_+Z_N>D>+8VV:/1FLE$`3UX%4D +MS%95::J_V+$"OP,NLRVF%K554!$)D9!#9 +MANQ%<,3'AZ\`OYWZ:-B6`032(Q>!-Y229`K\>GJJY!Q3`ZQ-&014"I(22*5? +MBMQGS/(H4W>_V>3C)9<_=.CVX&#WO@SAF)7=N&?GX?%?7D!'UT7#T7JWK5G- +M6&?VGQG>UM]>9>YOF'?TX%_?.U%B@KOW*1;'1X!F\S`L_ZQ(M0=GU;]`304O +MAVZB!$F9PZ?BOUM_07J>FT)QBJ&6).BW9/39$SN-4(X^3R +M8C(4=&%@64E,9<"8)I=3"+G!1V@[T]3D9-QN)P>IA3PA)B0DW]P@4=I4J[M- +M=-+KW;#;W4ZVMWU9W@IF_P)>^Y`TV&!1(&.2BIY+HOY_[N@S%9$/Q,OZCI;5 +M#@'C+`>;XJS`="T$50D]\"UP4I51+`O]_D+.->5?VOZTF/G>B]^&;[JJJ0TX +MZK`;'.SPI!HY^3R&VTE'S!FWZ/C4JCZ[V:_1=+VS]K'G)B>.'UU\XT^_R,]A)P8@@+CU/4M.-,U[:3MGIB#-K-B62*S1LBVE)_(F#3S][ +M^<;U1[WV"%@&G-9`?VB;/70MMAA#PB$:+<:5QQ#AJW,V_8CR%7<2N8Y]A +M&AR#9;^+)-VT6T`)V>@R%>B\E?)K4S6%.N7HC$"J6I6L&E2=5?U=I5(%ZDKH +M*GS:6``N.WT2@#MRQ9:99&VMBJV&2[>`W&&@8::B5DS_Z,@JX'KOQY7RDB?? +M/]^S9.;M=Y-::U+^\Y?N$;OM#0K+ZB&%&ZPE9P07`DB(7J&'UUM9,!S0A!](TU->88)33"3-W*D!C2JWC!K,:04D"P-V9IC\J-4&`GU(W2V-0 +MW@I^N!+V],D*7!7%@EA6X"(BA`2$^\5E@L".ZPR<(L2#MM[XSKCF>ZA@]WK<`^:`HXC(U:4GUHX$I^ +M^LF9+V9.]#1PT9"+X0FU9N>L+>BB_,WU;_5(BJ=9[MW"#Z&[H3ZX47XWW=O9 +MW)GI[=T4VM0\&B+P%B+OKQ'FQNE85ZP[/O=TYQ\[KW=2/3V]K=W=V<[U^=5B +MAZ>SV)6/XCZ>UJNJ4L9N,BCVV*P&%9[*]71G57C40%MEJ\O68:/GZVG:R?"\ +M+QJ).!E)PO.YG)/)9KN#"3*5Z.OK(HE<-B)*I#'/4?P\T4=OXV&:;^/G\_OY +M8SS.\_-(G)XO+9>>DXY*OY#^+%V3"*F;SK;L90,@8"KJ5Z[#)1M0]A%H;E;: +M/ZBTH-3B]0$=V`6XLN4;';BI)'VI"]A8@^(0R7(O*WM$I0*7+6*4UFT]5=5< +M6:5%61?Q((]0E6++(*>`)2@^4':$A\X!2H#GX4EY58XE3RGE&NIV-K@"0W/V +M#85[J@]@NFK&;C):TTYR]OY"K=F-XWM1U%J=/Y9K;LR^=@)!36SK>#H5JXV- +M_0[%XMTK/J[:-+1LUVITM]G5Y7YJYT_Z#\D%\X+IJUH[8S)RLUG=RJ=H6T;O +M-B$-&KJ*M?U^]9J7_HE,J`UJUO[AXOZ#BXX@$Y21$FC434O$S+(?K=M?[MK\ +MO5OH!<")#!OD-W&!:Q4%/I4TQOUK,J\*1X1QX8SP?OJ2<#YY,:W',EB+4!-O +MCF4*K?W4PLR3W"ASP$11<76"A`&572 +M:TCJ15EPB1UBCHM(DI/A'%RK@9%E)P.>(YDPZPE9A$AO/DBU.98[MCM0AY=K +MXY9RVSF,*^0<',UQ.1*FH=SL;'ADBE7*.`2@V!H&?PE/T?C(Y,#D`%M&`X#Q +M`(I37Z&AE,M?VC\("-LD/04]+(X-C:"$0P.11\)!J7WF\BZE,AYHQ?8>NMXC +M4!`E*OB?F@E7@\:BRR9J?ZY"=FSNV[LA6)LAJY['2!UM:^MV]#7T%=VM./8, +M25@0X1!!OWTUC<9>:*1Y`(DJBB_8Z`E+Z,"&'% +ML)*(?:M],GV33N,U/JV)-X,GKVP9.C'[>8_^/J;O_O: +MG@]^=:J_==NUB^>QUUY]\,+RA>]\\[VSO]#Y+85F^V7TWV60`A>T02&@1@H1 +MG(HTM12M!7[4.FH;Y>^W[E-F(G/*7.21Y#.N%YPON98\B]*?B+\13I:`SA2. +M"P0E>'G5)O"*C:.L"H<[PPD\=1IV:S:"T"F"HLAP7)-IXC3D-'^0I!)YK]G& +M<;&BKY5*(]/'4Y"BTFRZ]5_,A>[X5GI$V+2"2DU+:,*Z2K7Z%!Z[D_XD*P7\8]3?+"VBL0BXO#:\)$G_"] +MR=(79_L.__S<.W,#S8\?/=2??'3A"/YHS-T]^O?MI)E4+70L9`YKV."3VO3^ +M^=]>NS:E7?GUTMWEZ[]_V>CW+`"X@C^&$'Y:&_QI`@[9($&2-.63)"PQ)?]9 +M595$?XML"V`FMTH&G(@U9:#93#G&-35`ZCVX*@2"!AQ@^HN,4JES! +M5M!/<(>-C\*Z+U1W?,7&T[T +M0DM/KX[-I+VK8Z@PD4Q#7:H?H('T3>;C;ZP`]#6(3LBX/?H$0V"F82Q>DRKZ +M2,O@2DSO:KT891B`QB+HB"N;0NY`?D_W%A>_I5^0#NQMF_4T>5DI$;**Z^YK +MZ97S??G6TP<3QRU.@0G!YB]UW#O2U]+A>>@+L4)AVUS4:5^[NK-M-)]+;-@\ +ML7E7QL,-AU.9`Y7UL.[$=Q,$+VB@ID0%2'I$GY!EY3EZ0&Y&D1F@%H@[KRH^H6PO`-`QC^P^,,/S[U61XWD2R! +M0U@X83GY&LD+8MJGB=S(5SLSK7>XS-@;/HY.#CT@$"2&T6;JTNVK.QRAK'^+ +MS?65\?:P@=-PY3I^#O\&*($/M<>'W!#K%-O$]5$IVA9=GY.V4MN\(QUW%7=) +MN_(+TA/M-JTYF-R8+$OYCHYBH5#,Y7ST%+A/I12ZG]5*.8DC?&HXDG86.L(A +M(B=9.4YVE$K`E\O)#DGRL[1?]5'.?'I=M[G4*Y55P)=+(Z5CI3.EJR6R5.IE +M_?RGI*W2.<384IDM]S8.39V?QPR<^;?03+AJT'-];C90L\>8GTD4B`US@4&R +M[`R'$GB=NYN6=?]1+5UC!.1Z8+O;!O_)Q?J6^>AI`SVW]T"EP=2]C^&9\M'G +M2`;BIVA*='6>ZMV0#78]^2.2L=AL0:]9OO&6[I8,T.OYN>WWSHP9`O +MBQ;G7=9N2@I^*0!9DEN]J\E/><1WI\>_//#B:JO15;$?;/FB!O\%>Q$OX*\1Q4B2_2[U#GV08YG73(,NP +MWS;/5ET?U-.!$^!Z!$7TI<`G?N`M?\%N1C@@;GT#DJ(9$VO$9HL5<#;>[OCD +MY_[?/@080GL>;3@Z!D$1=4,93(`IL+]2:;BR$^P!TY5*Y0^5LY4?5]ZL/%]Y +MMO+,OX4'W:?RE__X3`;=']9R!5`'F4"Q4(LI%,7TE2),Z(H7%&HQAO389VHQ +MCC)VU&("Q7.UF$+QTFU#@[VEON36R3WC>U.;]NW%LM,38Y("TR +M,3<@,3`Q,"`X.#-=+T%S8V5N="`W-3`O0V%P2&5I9VAT(#8U,R]82&5I9VAT +M(#0T,2]4>7!E+T9O;G1$97-C%LP(#`@-3DU+C(R(#@T +M,ETO4&%R96YT(#$W(#`@4B]#;VYT96YT'1=+T5X=$=3=&%T93P\ +M+T=3,2`R-R`P(%(^/CX^#65N9&]B:@TS(#`@;V)J/#PO3&5N9W1H(#$R-C

Q7RX[CR!'\@OX''EG& +M2,-Z\3&WM8TQ8A^T]]'/1D--,5Z +ML3(K,B+J_3]^MMES]_#7QX?WCX]U9K/'W4.1+>IE76?X5V0Q5O2CL%EM_;+, +M'E\>WO^M*[--1WW\UVV.#\6R"$6=/6X>%ORSHF%?'Y[R'\S"%.+>,>6NB6[I\:URS#'GV*L\WX^C_2N<<9,K>.+OT^9?.E/5U/K!A(96S3KCPG7UZZK\T,;C1J;JZSL3*EH@HV]62YM/%L!K +MF;[6RU?FII3#E,GN#[+?S'QZ_"=GV"Y=\"Y[_#OGSE:>,F+AM=B`[-%G)J?AFMCW0>NF3MTW&X:&7A_9%RU]!*/:U4 +M(W8GZSLWO%V,J_)LIT'1-RWG=XAQX6+>IY#7.I-C#;1NUW**:?J;"7SL!HMR +MR]9X2RW9DZZPNO2?AA`4=PL-89(;%\>YX6SRRC2XRMOC]BX/;EDZ6X[RT&#Z +MLBAL&*6AINE]2YOQF@&+L_,4!6>`S_6PTNX.X05.6\$=:QT^]-.\`H>+K+QI +M=R>A:R=E@$&M8Y[D&_)!/M%``_C_)_WX-#<:UB0WI;W!S:7]HEMM+X!?Q)%4 +M7!+3/(6EJPH_Y*GDFA6\5$$3M3Z=#H8R9?/L8@`##2WE0E[?R]SVR!EN\JV^ZVR=^T6? +MQ'DNZCEP:25@8>Q/QGMJ_*3?O4<3XIZ@J;Y%TY%R5M&9\?\-ZGT&:#%91GJ2G+,F2V:5)&^<)IC,%S@%%<,UO0D[A1=D-A^1F%Y +MT&(D3'FNQC<48>"DR2*;-N.TEO2S0UXI_J,.2H,YG#CZ0*OOZ<.]+L#!T:(D +M!->ZY=S_1+3(X^XY3*.=\GNXR2QCQ=*Q,B6>L"4GY$)G3^Q4SE9K4_D_*XEQ +M-HEG_K*G]3P>VC0S];O=Y3R[7QNP5>SSN%&,8.]IJB^X<`R3T\$1K7^H[%V*3%0 +M8CZ#BL*M(ZIS;7WE+$1V855R5HP1O&UD@6&^J](XVK?T06FJ-'*%M:M<.Y^D +M$ZS'&AINP'#-VIR&5O4-V'9"<`HIE[\0SOCT5MI,_%[.ZVE1DV8,%6JM%FBL +M%6@=A!'NRW.-71+)T)-#I7J!B7U6KN4*Q,#4<=8.JM;(!J-'HCHEXM9PL;V^ +MZ2"4LI52%OSM4*>>#Q'3+_K^@DIJ.,+H>5G][$RQ(L2I^-J[8E6U=)#%4HZI +MD4`@%;L]BCF0G,SD\1:-X2K)026YZ_GPJ8SV1R7/9P-D#^]GIK6&$L7-/5>5 +MUO9N?Y"Y+/:J',7*\G[9\[V'W/]S1I>E&OSD2L&CN[ZMN3!*<04>-2!F +M[*C]+T9MG)\K$-W/),YX6R`$+)CARW]FF(2FAZOW+D/RWKX9:L"5.),%NR-` +M,!>J=/`=0JY%*-KL*Y,71+Z#<,U&JSD9[4DCZ8GNE;)UW[ +M.*S\EA9;,U/&.=ND\8WR`RTFO1\EZ`T@EW*KM`[QWE0D. +M``720IF`6"H^9DI(K1ZD`:>"(G;MJI>TOEV2Z#!C,4+THB3BM1-CQDMBV(OZ +MC54_`PMLP/%+$748;=3$_)2ZTNN\[W&L55_$9_!R2./K:>A%@!;TSYNR:&N&&8#$:!IFK`Y8]<"_[Q*=-CA1 +MH%L%3\G\CI)+57U+QV_TQY;-P&%A#+D@D"L5-OB7].ND*0&6IJ+1SJ)P5+;WA#J*E=]3$E9!N +MO5_^UDNOWB\3479Z9SW1_HJYVUY=ABN$@A^J(!;E6+[](-\UY)M"5'&6NXF# +M9M4X-R^,'GEW62NMO^G<_F:*-G:&ZV6?2O@X<,CL!H)FJ-]PQR'W'P<$A>M0V9K/1 +M$T5G1+"B5\.$&6JZOUZY9GI/P*TQLJ'NQ+PP*U&\(@U(\,Q)6[*#UT*I![&W +M([$/(O96Q1[,;$7K(07/2"[O'`%L38`39<3UJ[4JPPH+.9`%EW9VU%DR4`J[ +MS%-O?QH618I6TKXUWM+B^IB!!.*9U(OWM_4"LD9".JH$ET[1:2C<<9!F',G, +ME90"J0K_>Z^DPYV3OGQ.E]'HY#KD1<3[L8;OI$-MPB#O(PLL`T[R=AG+>C,Y +MTK(LDBLKB +MVGOARJ(AG<&M-]OI[(,LQBSKE&6A066J:3='LS-R$IP=MEHW@P.T#3N_[J0L +MN]D#@+*XIX8M>X&*_1V>[`G$"?+H`X.:!<$YI'+AI=:=T!]KQZ4C'J`#_,#1 +MUDP(>&HO-+645-1\Z/AFVXD+D\`>__)_#R]%;`M[DP+L3,22HS[3.S#$:L8> +M,`U@C\01'=03ROYFQ>"FI(.OKG8ICNV2&^Q2`[LDYB`FNVCE8-EB$ZH]HZ;` +M(45V+HQQ^$UU6`YVR:K#LC<.:\9$W%?W'#R`#L(!]`0WF_PS+B?V/FS:5%V. +MPB[B`(K")0W40TQ/VCFM=+X8`.WT8OBDS]K9HS,)G(PPA:CD?;U62Y(YU3D) +M9;CH6!6ZW1J5VN#H6!B>$9F5NQEC$KWO"(SI]S:UR:5GQC"5%/7H=C6VFZOC +M5LYBNE=:JB`K>54\\-]3K@QW$7YJOV";9`0O**8:7JD:8F?<-[9NOJ%2?'YK +M/:Q6;-;%R,6*-8;;<,P!:WN-!AI +M7Q;4LX!H[++M*B_$N^^&3SSPQ,<)9&Y-#),*@]>1,^WUJ +M/9J9R^>\@9G>IPH`<%$".0X7I^VS4E0]X)W +M%K2+2;QHP*,K'=;+!MZTO^W(N6VSLTX^Z=H=SM>J1?+\K5C+N>,]C3OJO#G_ +M,T,/5FKZECJ)B5O@T^9?X"'3&Z$6IRQ20#">84J"K1OY`#_-V?H:F#R/_V6^ +M2G;<1I+HK_`H`JV"R&1R\;&!AC&'F39@'VI0[8-<4DD:RR*MI5SU(_.]$^]% +M9)*4Z-XP/9B+J"1SC8QX2P\(A?(?`(J/,X"A@13@IE)LY:2)EH3Q!_V8,/CY +M;"N0:20MQ:U#=+)G>QXI&K/8AXAXLEN`O@RKV\PK6T!W^9!6M4AHARK^B-DG +M<)@AN,;A)@O@%L=0\1 +MHG]$F!<5Y8/.L+>1N_Y)7?$49C`X.MI*IY24_@8YJE]4,?1KMK:'BZUX_C4M +M\I>HZ=Y*N'PH3&@EG!G8AG6Q,"N11=N71UEBHL04;6T*6JT(WZL**7^_CJZR +M:QWM)&!/K``*1Z0LMU +M9RY)=0^Y(D:YV[<3!G-4)5ADOV:)R+:L=^2DE=\@>/&50Y?A\HV +M/N`SH,(U'#MB/=0C93`O!5MZ.>NW-002Z9PW=$(^8\A!5IT*5N7+>J#6ZEZM +ME4.UYJ):JZG67)1>CM*+QD(*!\8B6P3I)?'C->6S%QM['@VQEZ<4];$+VO8P +M$1IN\__(C?VWK54VAH.6B5//GDYV*@2_*!E\)&B#*M`PNTD)^54=<4-<-6-5%K2!+QJ2^?M#\;TM:1++(%V9(2[&C8#O9XCGC/5)[("%?0H"S8=*X*D@XH7BP".[UA_/$XQ=?-B/HH_XT0VYD26J"`L,T=J +M;;_O4.:D2:TUO-E,W!DWB4S'7AI-W9E/Y>C[N>A*Q9$T\9#9`)?#@D?E=FIJMY*@9LY(:N52!YF;=-CF! +M&:K9Y=-9!]BX,U6QY7VI"G!"$T\3N9'KZ"85[)4>C5S#G_TU]_4H/#ZO[\_K +MR^&E%O%2*[U45)<]>9_.5I_W?GNWU+SI;=GLVV"Y' +MH;T%INC#4#EBDJ%]06"=_HQ)#$X/ZP4:I(QM2SV5IOTU5+T,%+ +MN@C?)9&QV^27F0Y[E4^Y=OTE-5XY:]=(9B(AP)G&:5/TXB:A:JPQ",BYN@:O +MUZ3TO+:"/JD=F@A4E3=5+TJ+,HA2P!?F5G/:4(03*0HBH$A?+N*UQ0A2?1TN +M7U+XDT_K\*:U;D_6[I:#@3+-:>+(W-45HXYMKE[8IKT@X1!)MI_"/=*;NU95]-CMCEI_^#COK9S_^G-;P?.]% +M["+?WD,2Y"A3BO`#]IJ+RN`C>8OR*7%U2&;VZ/33=I=FV/4C8BC)LYAB],6- +MYND9W;+GI]1#>@09%-1M\J"ND_IF +M98F]Z;KVR`KRPQK$WJSG11^B=+UDH'YC$4ONMT_V1XM[M4/5E9HR<'/\N-:% +MCZ/6@54$2M*E59!489>=?=[:VTR2+V$ +M9ZYB$$[GD3+X(B@$%+U#@&,^_BRLAN(BH +MD<%+XM1O1;\WU&)S$]"85G;D$3*YR,QQM;G##D]I1I!:25LOD8.?!2(RE6VA +M>\-;R:!EDP=YG:M"P!I9FC5\L/4Q+6L)R9NTR*;8Z1I@IGC\@T+GJ\:KNV9P +MO1YS=>8`/^G+3T/FIAC8ZH=D&^RDSX/[5+MH_!^_B[D\V$)=6,FZRR>;U1[] +MSG21Z$,G'"KG"#/K`QDZV^GZ^^!*58UL;.KGL"UL=*%^IS!IF=%!R*YK#&AG`3[^^VMC9PG,73C"`FE_)V*U>@MZ6[N1+RDJB +MK@SI8E>U&:47>W1;2X='3385GVTWEICM(7QA1@SS\TU0LV/@"`F1!2WH0$C8 +M^0,CT,SN!7CA8S\F+XQ%-A,I=2LM757W&CQS59"6I>47=4!.7LQ5"@N\7KA] +M*F7`3$U,A8(Y6)#N4[B:.MJAB`"[B>DYVMRXT&N*Y_)3U'+&*9OHP$1XE;)0,IYN;E?LHZL'-UKXW +M#2Y>;0TT*Y_?JNKA/^+)(BD\`5B7>BV&1;7XAW=3$X[6J) +M.J?/6S`AV;HY;JY%$`UEV>=&&Z,@E7%4#2"A9I83[@_TYGU*G:2\A0++)`DD8$=4JD&,GU[;'?&LR7P[I +M#%@7#-`.F\'\G&?%R<(D'E?2IJQ)WLX.DXFE=2HF;9Q\/\?=;70&;(V]XZ[1 +MSW#%0GF-UGG('^AWQ'.)C92P8TM`76;:5=V.@MS!VD*?@-;.$G?Y^#G\8\*@ +M@[;7@AKC"^Y9D6#>>[/+.\V2`TFM/I*=3A',TG)#D(\F +M*E%V\,8.I;)#_]G6($EPG+)1!9(PY]C:EZ,VD2U"TQ5%AWK!(:1YM1]XWV\% +MG\7?X2I<%%0C.F<`Q\23U2Z$L6HL0Q[N34Q^Q"Z2#ZDZDQSV[#,LWT0AR^1U +MV=_.0,'EBPCR68:"-;UNKJ#35GQ)2<_CFR)KK:87V`2"Y$:D*+YI#]A0J&;:D)QL +M:E^B:N$&K^)0#%1+$=0NY<-]6B$64!1S?20F,"@VO@+[,E8J-3>"`B%VI[!: +M!_&28)ZY3BGE$-4/-.L\7\1N#SJW5"\$MBUH0?EW(5192O9@,^;&$?2+I,Z)4U"0#4 +M;]#MEST%?$9I)L"RLR9<)9-9Y2OEFPD]WB:`B47*%<(HAF>8;KFFFU1R[>KK +M:@V:_I@2U-O-+5L+<`2VQ@CAO@__&DXL]R3YT?.Y@O2#B&#B>C4[JE$%&T,% +M55H@Q12@Y-7"#2I")UIO.*Z`KR'?FY70*_LA&7\!2*!<=I4>NRM"^=F>K7NZT"86@SJ5)WH*F"[CA5$^VPWQ +MH0?BL'D,KP'/"KY:]2MR&$:QY/?=96]FG71-NJ@&95ZJT[Y#,@,^2+QKXBNX +M;(\\S.1TZ9QJV;0JUHBL+OVD7WT:B\PI^IWY6VZ6@Q/*L,,P8E%5^5>05Z0ZQJT<: +M7Z'C"Q3U,*/;*`3J[3<;V1,B-?S)F2=RTC3^3+S5<;PS'7JPL\)^X[2.[\^+ +M_:\,"[K)^_>5@AG;V[MF,?*A+\/M\\RP*=0,=JBUJ!%;J2E!:<\Z\#=5.7-) +M.$2^P@YOMV[,&PVLK1J[ZX*0BWH>R$Y/+$,Y[$:@8@7/0@99/<.S-KUWJ7]) +M)(JU9GZAJJ5492*#1WW]UEU-($-M4.%]J2_(;3-]KF[S%7^SNZ_C$/T0FY>&"A+N3L. +M4:\_01N)&Z!VDJ(+8-P5%F1+6E>S_!LO +M4R/I&]4SOJ)@D<,8)$^K1./-5?E$KJ5L/B?7<--<](D>08]ZB[`S3S.-JH9E +M`#75L1!#F>])Z45<)U1K0NUC@DS]I*W#![Y85*Y$<:91E@RZT56RMK<_K1U* +M7!5;\CD.&^S[YLQ&<+)R,.NB%6;5T1;V-G^%=NF1>P#D33%S^C-`)"85X,8_ +MJ&M)#4Y!*>Q)BD&@5:=SHJGFAQ`()(JRGH?`Q_I632%(52>3MQD"#0#=[[5> +MD<'I_K@"SC\;IX?5=,TTXX[_>P*F,3FEM:ED%6%,R')A#F/";YNPV6!'65@_ +MDCTEX"CU'Y+5OM"NOTPX/_-W]U^>*%Z&[.*_-F&_`#9CW12P9NDFIE\7GG@YN4R6#\J?5_&(E0']0D<=_I.%BC( +M`L76QGJ^M%U8\:B:8/.?E'NUN@UE'?`OHWB0`(6ZOY+@43S1$SZZPEM^7VA1 +M328M5#.SC_IF3_L\DY-\#2YSYK+,7.9XT69R5497X,-A7U1E-J%(R')-_DD%+(1$)UV1!]>:BCW(Q7/T&&STT,D5 +M($^V=UIT4$K?E9B..JI*SDD1!LD3@7P'#9LRJ.+2T?8/YPQV0K_9/]NZX69_ +MJ#V#QC0WXL]7A!7JF@\;#%:T^FJC*YBE!^[[Q*`L3-S)K3WZ5M5GRD:(\0B5 +M4L^;K]8BKCFA)K-WK/DMAR\J#J^6_8C9O!AZU9< +M3:\*WGO-@U/1)Y:,FZ[L#$J6.KQ7+Z$.0I;\HBB(/0-7VBCD7WIRT(2C.; +MTNW)!B4<2-)]DH8*O]T!I&[[>^(S=?7VVKX1YA6E2IYRT-[%^>2)BJ6=6FY/ +M@WG[%"*]P(UU;R0>.`!"@=J>/W(J'[&9+6327H=?QTHVM1N4M(8XO(48/ +M=4THQ\U88E(!YJ??D@R`>$^\-JFE5C7T,EK);IA*+K\\\)U +MEUHJG7.MRATM#QZE&RVHI*+@[;+"LO/@\75*F2I8DC*T'GB45=KD\/W4W0DQXUE,"U(%`,WF_<=3&>MNEU=>. +M+JGCV4_P[R.6[?[Y//'/Q(>XB^(6:@7=@^0N[#H;PP`9ZA\3P6Z-%BK73-V! +M+\O("Z4!F]I!-DM-7B%D^']%!9:R_R4I41EOHOHPC?`>C[9*>*2.)9[S.2(2 +MD>!)-->"(^==50ZL\`#O]X#-.E:) +M+-[2-Z8),U.=4!WO]GY8?!\W[+RVVH\%2&E0R9RAF=J'!9H]QC%N#>G-4U/E +MLUBX$(LB#XC/G2+;H6B/9_MSBB/`I]`&11(ZA$*U6$X+E>SXY<)F]G@-"WM[ +MPH^Q/=/E+RHH),X>.+^I#2<+,4[70SO=66^UT[LL_>[F'=K59'F'(B.E]<8\ +M**TBRA\1'+O":W;6T'Y/%.Z/G0J$%V(J5:HJROK_EWMGF@+]NLNVE[UJOP[< +MG&EGX,);$(&0?[%/?23#.SIM;Y%=X.C2P%.OJ1M7I3-(I/%&OK(;O79*!;T] +M+PGAM0]D[3)BDB92UD#ZL[5I=<$`S7(8>I4N@+1-W.OW5^H:76+`X*YVPK.- +MG?0D+EG1,KS'O9;Q+I^CX5UH6O#P]UXHJTA2E?6/HW_7/ER3W +MF@M>E5M%7U1L>=ND<.'3P1;JH]?!S4V?5W@`54OFO^J,+JDFEYQ/JE@'D:QU +ME/Y_YX*\OBNSYG$+Q<(+$H"L;B8L^(D>C,-:@!N,DZE`\*PU'+LA.:LPN!_U +MV4'8;3WC6ALE+L/`LG2=DE)&,\FE,U"&;Q5&/-%MMM-,+//C3W+&0+7Y.,&C: +M(.>T($J#TZE:_+I2!M-:*L%?(XP`8-"_)G5&+/'!(4-=B_\*#(/6'(/GP7`J +MLJ-0#96Q@53H3."=?$)S>U_U$HJ&;0]?F! +M9"Y1^]RIB>1&_.E;?=HK38,0REB"=\X4=*5J/"/85-!%BA77J!8N((/&GS;SN1R[\-("X/!A6'P8 +M']PN#)F+KV//XR>_9TY-^H6P@26HI[\FN.7FR#*=68&G$"V>M&#@X/ZP$4[= +M'BA>MQV"P^EA&0S+32Z7:U1J=BU`/AD'=0?C.A7H#'Z^UW^+HP$GL=VYL\CT&O(P +M1SN4J(JN8H$&B8'D7KQ6X7E5%]<`>"`ZDP[+7P/D9.%:0''= +M"T$V[=OW1^):.?LA9\T!*3^8W15<8OX<"3MQMK@232J!H0Y'/1MJ[WS.:.#K +M"_U*=FW/\M2\9]TK$L2AT@Y=NX=\L\&+>_'@I]2?'R;].<3WYG*U8,F`$9!]R!AV1RSTKNY4M[^^T,7"^Q)9RG +M!WE#/?"74.IU/\("U9[=Z4$0=F`T<5+BR5UYU]T#2_!J%E[YU5<@,*/)LW:R2=L_9:87/)QW +M.I-VV10@)3$)"/U*0>/!@&QCW_#J6D^5",2LF"B>@<:&PM+@+0NFQ%-K\V;+ +M6J8%^ZH0,LG7';^V!&F^IS4[<%L?7+7KE/TS:5-2J7'F@=L['UCI_H4N2PZK +M7E04,^4*&:?_I[WC1/"M-+D>8`))Q]>ZHOW"F?;+XI`X=3XVB5R;$%D34'O6 +M`;1)0F<)>`.\#SB.G(N0/FP@&XXD`.0CNVNUZ9)K6IS3&[&&&AA&*FV67Y^T +M,_RWAF\=E6]K%_HGO(',S%"Z[7>E/HW+S[^E*B?S"L^P2"E`6G;:M7T=#5W7 +M&MQV[&?.P_CK;7MCOP?0HBN9/J$"/T5XMBX0';8N),H/6B57+RJ6ZXV5MD+^ +MM0XFYTR89.DRH##MMK/NL5?U!?^#MJV&R%K9U1K#>`""_=&:I-%IW[/?F*!A +MA[O6VN#1><\^>7B1&17-1\@D],[*$H$GJ5O[*YE#(XV1C2J'2)W>_M> +MAS5X6,$<7(QD0^!R;>)H6E`CLV1S7*R5[QD9-/:W4.1.6OU=,,B%]@D-V<`) +M[\S@Q0EF:L/8%2`+7/\D!]7:S#G>VS[?[QY?N!(;!RX]':!7HGN +MEC4&"*A[(&!SRYX(Q!%%:#4C[H(-%YC<":L/((:K-*O9:CB[],W?+AY!]%K= +MA`EHCPHUR\8&@'HQIAZ45C=*LH,P=1VE0A2HV%G&;FW]8T(Q@IAP)+U@2@Q&087!YI^;GYT60D]3! +M4J3<)1;WVH4%UB4(TX^MS:^4&-T?P%FN9CY='OO*R!ER@T^@G*6OA"#.53"1 +M&F_L^X%O+>:_I8VF(*?[1Q]'LI8&`'-EGER!E=1ZJ`OAMU80*B#^L,6GHSNS +MN=="FUHD6;\)\=1#]6!"\6MQ\?>4Q/J8&K_FH"]>=->*AH$Z:^9ABDP[TF-A +M`@LX%0WWH/UNKG`4J=E:@&U^"G*,/')(DP;7)+1UBFE+H0=`#Y!`;4D'?>C$ +MOK=4>G+R>KICI+/5R1HELLEP!DT\^+2P6%^ZL5\_[1*W>9ESJC,D4U97TQCE +MUJ:B:@YY)A(A>U:Z+E&10=BGG92E*)HD\$\Z7R$^4!+4%T=>BRD#^^I7OPKJ+P)@'YUA[ +M"@W!4+,&:E(T/7:X43VS'T':JWR_F$?CA,HPG/KDF:M^8N%;#TGK?V&M +M4(>6F!LGYM=FWH_Y#CX(#V_I1W--+?#VT\@.09757_X-")4&62?\;YX$B7!3 +M)J$4("KG8N1)D[0>DW1425$;:2%9M;;?3@5#8KIW:X+7=,03E54&%+[)-6-# +MF`+/<:_D&>7_YJ^2E?'].ZTSV +M?481%Q:?+W^^B`*&<,VAO6>5)<<[J">27FTE;/(="BWRTN@S_DN%4LQ^(0XT +MOFK3]:C?X-,+/E9DVLF=I9C98'])]:E))C9W3)Q<9.Y77V#0_N'EI[<^](8, +MO)1;-[.7?Q\MZ?FO4I2]VCTS\MIXQPE*RDB!59NVK5%@*2GOA\B.961`[\\$KV5%@[D6:`:D^@YO6LR^R +M,M)'CG+#1SXSK11124U5Z$O$W)IKJS3VY1L"5Y#U#-$`+N +M>&L+>=S@D,Y)U#*<=HN-65H.-CX.%[@I$;/?[-=/'=QX91-K\Q,*+Y`HR[L, +MD6K'6W'5OU@U]27(>4:?)',^4L.Y]H@\XBJIV3?T*-[_>P(J:)V/#1W!G;/ +M>H8/MYME3V]RA]#Q"0F +MRRGM'%EL488AU"XQWZ<%"JP%FQ""TJ-#`JA6RA($+/I5NUX_ZVBK]=IGD% +ML+'#3ES003MLJ3^G_IC/FY,E/^'E<>1M,7C7C9KYD:HNZ+LV5(Z]\_WY?,@MZS7&F\'C@F54FY(M+Y?[CD6K+38JI0JU +M@@VZW9+X*G1`^5MAC*^@RJT:[7F<>")P-V/*`SLBL*,8&+ZX$(M&(%;N5A=Y +M)I!\6&S^5*O>'41CWDQZX[)%^N14;[F6+"C!\J^IM+I&L)>SVW1N/C2JZ;CV +M;M@CZ*9,J49X;D&14(CBJHBVS;)3*YTQJ5N3!8OAF^N/QJ2^>NGB'RYP8S>8 +ME+(&/@P$.NIMWH!UX?5>TE667 +M-_;UF@]3*`L,>)>O]IUL[81[="E)9MX*1[5+M_7$9DS\9_HLTOE8X*TM]Y-] +MEXM`/U@3@,R5QOQ&>SUW80[[&:U]K_W"$W08.73PP-TQ[[B](-J>?&[NMU*I +M2-BGM&9'HC#H=7:%CI7/%@>\.(*S1PYJ%.]7GF_TM^./3*"6N7UN&-/^,S]:C:Y +M^@_?5=.<(`Q$?P'_(4^M?J0Y+>]!Q.7^(&KKUE+<>5`=P^J[I\3GFT@)64K*.5JZD\%=G'4D +MJ5QRIU=(%>*S%X6N)EJ/'_*]'V5@R`IN:2G"`#$6FXDGM6-46\=IH`]QI4H- +MMN+C@%T6AGMAN2\@+[!/P$!=C'J\PW.9J[SU(YW3'-A:)VT:V?4@NW;JM6XW +MKWCKO`;35QQ-`O8']@8NG]M8#B>LMNM'/$6DOV905?H/SP#EN=Q'GG$AS'B& +MJ#8=AA,]'U=TCH=TQ6('T@059$`=3/^7&?49D+&B"P*7`]P6:W67#DNJ`<@# +M2!P@_1#]6X@G\XSZW914,;_\K"<)D<]*5O<1'+;]AI76>,SP>MM.IM/%.RRY +MDG'&PN/*$24J87VVZ0623Q-4^VE\F^6$)$(*!1=>3E4#W]8QG<3L(D0T\.N9 +M0#9$WS_&Z-WM+O.UQHY?MS)*O8=7)\1R?W<.QN=&@O!;?%H_T8NJSX.P4F3` +MEHD90+:-<-2>E>,N1EGQDI$D4'@;Q'X?:;HHI72I,!$;H9?`J2^`^D7ZEI%Z +M>LNP>S6G9J.\W7Q.3$\[+9$8?'JO/6Y!/28TI])SG7PGUGR9!,`6U`C\%L[X +M$A1G,!4D<5<^ +MLAA0JHR1M!H2Q8]5$6M3;6JT$U-KXQ!>+='G3,W85(2/3M^9N^?<<\\]'[]S[P5B(DJB5I+(5=T8:'ID3>40 +MHF_F$_'NZI7-RNM[?_@^+,X0R4I=TU.-NYNWQD"^@;'QJ8:6NL[*["E$PUU$ +M^5N"M8&:C^9?/D)4/@-[I@:A2!J7<)8HL1GS,<'&YE6]&?&?8[X+\W<;EE4' +MRD_['R5:`/_4T!A8U137DO`;[$_'7%D::*P]<6KP'*+26\C'WK1L13/RQ%?Z +MKKG>M+RV:>G-;\]"`0U$\>?D(*5C9&!8I2Y*)3(N8%PU1[C*N"LWDBU\VK@H +M38(W9W3@RZ$EM(XFT5GX/D,R_80.42%[H#]!*6S#RI.TB&>0A[TT`%ZKZ>_\ +M&-51)WU,FT4"-9(+UDZ:`G_IM)!ZR$;U1IB*:26%J)T.8*V,VHVSQA5$FX1H +MRV@];>/1D#OI*%WB!J.',JB0EM)!NL`SC0.PLR+2;$L6LIA.;OH&S8?G*EI$ +M-?#X"NVC<]QBK#=Z4&$LXDVD7.2UGPZC@CL\A5ND0NDEK!2"WJ'W>"`7&A7& +M+XQ3B#.>"N#+1UM`';2+7J4CU$=ASN8R[C2>-I8;1\B.6$%ZGC;23GJ9?DV? +M!RT$Y@=8Q^A5Z=`F+OT1]!'])';.$4'HY(:8AC +MXS'\,,\!E:`N+R_G5T"7N5>@*"%$MU0L;;>0I4W.D5N,AXP<(P_T.]0@`?D1 +M0"F7'J&9DC*Q-Y*BB/75R,3$IX'OJTD!]#1E6\B&NXE;?S]_@(Z$U^BWOXS]S+ +M-_E.)$M9)*)KQ:),5(C58B?HD#@OC9-N6D9;LBPNRT7+!W*JG"=7R2_*!V/B +M8]^X>R/<&>XV+,8\H]W88YPWKE,"#:$IM`"W8#%J6(8:FO%>;*,=H)V@O<#R +MISC)AW&.CJ/'/:#3H#/T!Z!Z&=W[`/0WG+$^U/@9ZDL`QE$R.YH:Z6@!SV0W +MJJL`>;D.9Z.)G^'5H'9^B?<"^5?Y`$Y6-VJ\G][F*Z"_\#54?8OOH.ZA(ALT +M+U+SX^(YT0IJ$S_`">D4)T&WI6'29&FA]+C4(NV2#D@_DTY+U]''.DO(LL?R +MIN6<3'*&/%>NEEOD#?*/Y"[YC'Q>[HT9$],9NRUV1VPONE*)WA30@U\*3MB/ +MZ9<4%"M%-UZ$T63!7>_B9OJGB$-5SW`*>MT"]+)QZ[_%:RA93!3?9P=ZM$\N +MD7;B3+R(MR(/-_82[E8Q;@CJW%=;I:;T=P2&H5A +MQN#^-ZN!"O,];"QXS?2Z.1V0MX'S(ITS5NK'V,^I!-R1@]*CTM=:1U +MQ/!A0U.&#$X>-'!`4F)"?%QLC&R1!)/#HQ;Y%6VL7[.,5>?.=9IS-0!%X#Z% +M7U.@*GK01E/\$3/E04L7+.N^8NF*6KKN67*R,H-F.!V*1U6TW[I51>>J,B_D +MK6[5IVA]$7E^1.Z(R`,@VVS8H'BL0;>BL5_Q:$4K@R&/WPUW1_%'B1*<#H!- +M+DHT'6LT.[`Z:`4S+3Q:JNKV:"-5=V1-LGL"-5IIF=?C3K/9?$Z'QK.KU<4: +MJ87:H*S^[>8^!:;E7L1V.NK-_&ES4HU:LUEWT6*_*06>\&I2P*<)OQEC<)8V +M0G5K(Y[]T/KE]`O)L^6^14W8BP*UH2)`LWEN=.HW9X$MF)54*'`KVGQ>C=M\ +MT20BN4>KJ%4]IL:_1-'BU4(U&%KB!^94[CV4ZDKUJ`&W3Z-2[Z&1KI&1B=-Q +MU+IFN@V@''7.9/;3Z%JO-AAL_'J+)>BY_M#R5/PRY-MB>K2N@30J/4OAL/:@+]FAA[ +M\B=DBF8[[YT(K/?+.HUSE.@47^K].7.[3V>C32?WJ*,43]*B)[$\WCP.]6[L +MQN1A!Q29-DB9#J4(61>9?5-"2JBX)J04*4$TW&*/<"S4AGS9**?"6X_?1[TV +MS>5+NR?6^GS3X"?+]&.)^`GYX&%)OX9OJIP]2MTBCC`4=&YM32RU*K:TDR%:E-M2,OG1JB).%Y?M%>G +M2?\=X$)X0^ZFI>>#+C2D@NX"`L4"\1E4FMQ"M@[Q/[B&[7$DV\!*, +M=%.V7"4;]I1(HZ"O)'OL5NA[(KI"<\V4+2MH#M9R3#F.X`,<_C9A%,)W#M95 +M:2ME@N>`3X`^'?ILS&VB(+(_PF->B\I8Z(CIB!7#=+'YT)R,H;H(@:7H8A/8$%UL!!NLBPU@R;I8#S9(%VU@ +M`W6Q#FR`+M:")>GB!;!$73P/EJ"+5K!X73P'%J>+-6"QNE@-%J.+[X+)NO@. +MF$47SX))NF@!$[I8!<;1&6'F&C8GXW(QOUW,2B8K>=SAXXXQ_&_FJSXVBN.* +MS^S>Q]['WH=]/M\=-N/S^6RSYK@S_HI;@]>I7;S^`D&@'+VCCIV+(2:`^18B +M#5`*M:T8(=(6T0@L(%%;MXIO[9IS0(4(MP0*:MJD#8UH@QJ'JFJ=-!5)R(=Q +MW\P>A4KN'_VO*[WW>[OO-_/>OIF=G3E<%^;:890X)T!_ +MP/3KC/%K+@'Z`O9UIB'F=[$/0EZ*=A+N2[HA3`VX;I4+,AU%JX<7T,] +M2,033`\Q;91=/>*U'O&5'O&E'G%OC_CE'K&R1ZPSX]_`7D'$2:833!?*EBKQ +MAU7BCBHQ4$4I?X%-KXB;F,YA.EMV1<7)J/AJ5#P9%=NCXJJH6!`5Z]RX#XX& +M(OX6T_N9WLWT.J:7,RTQ[92=Q>*-8O%$L?B#8K&C6'RD6#R'[;"=%;%9MHV* +M[XZ*1:/BW%%Q=([X"KZ*[-BFVI%I'%_%X)T[9R-)X4_5F`?@C@;_5&.Y`!^H +ML2#`^VJLD-1Y\6T4$Z`^^#T4PZL`_XP&=?3^C[B;HW@3=[/[MY&$@X`W5.D< +M-']+@]]K\*8JK0%X796*`:ZK4C[`KS1X397F`OQ"5?(`7E650H"+JK(`X(*J +MA`'.J4H'0$I5)@'.:C"BAC8`J&IH'SF/AU&(&X+P>]68%YX^J\9R`)Y18Y4` +M>]38(Z0NA'>B09;CMO0[;(7[XX`]@/3=-J,!YM^$!IA_(^YF]T\#4O]3N)O5 +M8CV<-VF[+GAGBIVJU`1AUJK2?("HJI0"K%:5Y:1.Q"N1PCI[#"DLPQ5(88V6 +MJ:$AH"U50Y.0?VLZ_Q8U=)W4F7`S"F/:2D%!QFY4@R>`79H>E7!Z-$+I-RB! +MS"G.0S(;E2)80R@&(4/*"VCCD*]*1P'\JK0$($^5Y@'D:@/@T2KO5A7Z+IFT +MNN>Q`X58>XOL@OB?Q0CY-%9`[@Y.DD]`[HS32:"2#Z44#LK9Y!_2)'E?6DBF +MI%+R=\E,W@L%R%L#YV@FZ`U@Y&61-R0G^:V20:X')\D$S+=+L1/DHM1!+L`$ +M>5E.Z;!L)S^5RLE/%"L94C:0'RGT629Y`=H<5XZ2YZ'=<](&TA?4GN^7?60? +M3)*=T,^64`[9'$KAXV-D4ZB"/!T&4R7=04ANC#P5/$K6!5,"I-LYD.*P;"%? +MAUS6*//)2H7>FXG1(!&>D^@ZM55;V+9H:UB/MK!MUE:M3=H:ME9;KM9JZ]LW +MM*5L[<@2LB0,W8V1KRCY9!%$&E))#4U6)=4*"U\62M&B109IT2K(_%`Q(8J9 +MK$P:OV;\DK'"6&Y<8"PT^HVYQARC2\@0'()-L`IF01`,@D[@!"2X4C.WY`($ +MZY;+X*!@T%&MXZBF_RSXF7%8X%!3G8?K0P+W'9"#(`=`]H/L!?DFR!Z0W2"[ +M0':`],W<&J&MQ[D^;L^H0S/W<+O3#W=S!]/606Y7VMK%[6!6"I#&!$PV(;IG +M&<;/>=P[:CVU&8N=U5^MGT6UIW7)@\OSWQK,QGW(Q+G#WX/_^_"/QUNXRH;E]#G>4A\%6@NCH4&N`F@H1@%H +M?#X:I#0TR.[D8R=";+C.6UXV[*PMU>.^O,S>(%@T!1@I22+`D"(1DL8>ZB +M!^Z0G[F[-7>W%@,_\(>UYG[-[P=_R?_3E7CT?VTQTG^K]PP]RM]%BML[^A<1_'QQ/"M0*)^N#=0GY?L/S.+^PQU]P?JD^A, +MPV.KDV?D1+W:+_>SD]I(VZF6(_\1J_??L5I.S=+9*=I9"XW5=F06]Q'J;J.Q +MCM!81VBL-KF-Q6I8O^+1K0]=V[=MTXS9R[`5L0UJ$':S-OTZQ",CJI-S]`8" +M/P&=D?#(K-<1GN=\)H.18.058!5;,.+O6@:?3MN=FM;IFC;'QS6MCND:5%LS +M74.E-%+F]#N+0(+ZOU[^_$7]NL^.7>;?_J(0OO'3]P:X'+P(>5";7'(>G?5< +M@9`>C]6(=#H;\EB$3F?$:K'HJGW9V3[7)9O7Z[ODWQAGP5JGVQH2];=;IVBD +M:6=9&79F9%:YA433>'-M^H/'0O7-R9$53EFC5KU):V_=M>/%08QODM@:OY9JY9DB(R'!. +MPCX]\NKT*5PVXM_X!,U@TG$;A5NOET8R_5G^-?C#>W:N>0JQQ?+TS+MX&M[+ +M@@KE3"XB6$3(7Q^Q>*WBW73K^_FCVM:ITLABS!)DR9Y.-#8FJ-Q(:);6YP&$ +M^%[]7N1"VV7K2]8QZR^MO[-^8M7S=1DX#@0S&KLMVNXWF739]IO>#&;IL]A;O'^&$=UKFSPM?>C,.878NC +MVEJHYD?QJ2_P1R4EI1$4KUI86>$LAXI"%2N"94Z7NRS+W_O"ZD#86^ZOYO0% +MC<]/H]*5._FL%MEI=I>_\WG/YF6EVGQB]>`O0SVR486<(T0XHRWBLGBA*LZ[ +MV5`82[;7X[WKWWXX/8\<4XX'Y:F%`F54/BB0XR'[])-+&A/W"T:%[TAHCZ9_ +M?K]\/)W/^N_K#X%5`/;?Y*YON[#!;+#,,U6;JLQ-6#$IYO7F+M=V5R_N-_69 +M>ZU]KKZLUU`&Q_MR!),78;?9XEZ48;&8#SMF'%Q.*$,03"9!R"DPFS"G"UC< +M=H?;(N3H?#K,_<&,^)!WQH=]*?Q=.BZNR_!6+,?TPPMAO,!JR7-GN["P_YH,3SO%[_R*\W&*CN.XP/F>VM[,,IQE:TBZOB'08O?AE +M\#FX8<2,+NKA^%'RF;G"Y'.XII'>95*#O_K@_N@ZM:[*"C3(&4H54S",_"?, +M$!D2;\!&]2Z3P^WH%X;M1QQ3=I/)\;QGL&:_YPOAGO!EC9E,8+*LJE1"9M0( +MF:[F76E*B0ZF&L;2@$WKZ=WI3]-D.BTS2LK*X-4IKU>V!/)@UP=.9YWHJNL1 +M\_B.R2:U(4/!(K7];%-CJC"+>-TK?81`HHQ@B^UM1;3(Y6X5.<0.+I"T$:9F +ME!<5<,7/*>C73&L[B0Q\,W3K_ +M_)X-/S&FC+G23OS\D8U#>B-P>E:]N?<[:W^F$:[0%N+FEJ"+TFK673U\JLHE +M:/WGWO\S/G=P=.]8;8NAE;[KJ1L]<>,;=82!O+)ZX1K5!QDBI7ZL]^[D#]@/ +M\*_XOV=_VS\2'%'>C>29B-I]1;@L_DV\(\Z+O"`(BACI<#\B='@WB)ND +M'=(^]Y#XJGW8/2P,B^/N<6%4.#$"3,YXRM2J/;'FC7-_^F735H"/'EL[F'FI^T=3QM5/ +M/K]>``F*.K*U33&4TUO&C>\;?_G[Z\:]S4V[&U]M^];$1=`%UE[Y(U7)'1_T +M_5&HP2J8A_T;;1TV?K +M\QSSG;2=O#WOXY`^J[)E?68C)"4&4C`*<#'EV*'8\1,8ADHJ8JF(%OG^WP=5B=VE>0YA&37*X@ +M>3-%R8M$X\V4VKS2XE?E7U!'A9GVF0+Z/E3,E8IHW`.VK0*O:=D#]+A(/2@; +M4R@+"R[05$(J(X"R.=JZ(IPE3S?&?_.OWJ8S!Q5-$X;//#KPT9?;6M>7_J$1 +M[M#F16,:WYPZ$5]NQ/"7?U7J/'/<8!])C5PU-J$@`^4<>Q]J*(*=U)DA!\@Z +M`"8!"3&J2CHKM'3.[U=86K:Q*097,#EL">>!J*L!W2O*2L5`4L"NV^'"IMM^ +M;R-L45<@0S(1];^*F47QSA[Z+`?QE!"*@ZE$>\K7&V,3=+0WC>P.:YC[\TUU[2L%%"MF@RP0I_.Z=ZA8C1IP8 +M*W6.CQB1K4VX5M'1ZH7K)AKB2&+UV*2N]?&O84>Y:3!52]&P6UAXNM:#>?'' +MR<<=6_@!;H@[6O,._BXW4N>,MLA*-BPGY%`>^'0Z0LM,GTVV6E'N,'TFE#M> +MHIZHKT]&8[&H3`@A11'8%$$(J6I:SH/:2>O**S$`U=0WH:1=/4D4/.D4"AYV +M:A8&.09#I\1!5%(;&HP\S'4T-K]*GR73\3!<&H6O)Q#+-\$`RH`*/;<#N#D3 +M68XBL/I"`60.SP>5A+V21%/G?G[WY:2W-?H"_N'@8RN-3W]K_*+P(7Z5N''U +MVM;Z5"6+WC,N+6#&KN9@^U]S?A[-QC6#QES-AFO3((7?K/@1+T*.`NQ!3^G5 +M+'2<&D;9(BS-/BXAN^$O2Y&D`!-&<%M$0H02ZYMD16Z,(L_CVS$I!=.EM>T+ +M9!78#."YUZ#NWI!^4`QN--XK)0TH3\<>7J'VX(5M:MNV;24-;-=P5ZB;N-D= +M=)%PEWRP9U[9M!Q-;E#N2EZH=P^V>]+#.%MD*[JZNG!E?Y23$5TI3(;5#6[/ +M8_%\[-4%67%"1V#B+O&P>%PDR\-8=K)C)#+_6=F[%(>Y0@XZWRO!>H>VWIIB +MBS.HRH!%@W]M_^@ZEMRL1#>HF>5PVA8.K5^UX_Q<=]OZN=X'1ZM&/KQ_OG5E +MW8]GC#0\`\Q]1 +M/$4U3#R+R7'D6DXE$[)%C?`M\%HBX5$YA@#8(F&9)\@X9R7]2G[AF)YD@H$0 +M?)PD^4#`;Z7?"H)@2`V!T!A/TTPH&/#;K`QMD<.,-:2L].=!5G?;[3;:@EOO +M!^.Q8$`4+#YYC./1W58KX21)H+M-I"JHT%.J7/[:R@,$_I9N06V7WSCD<'UM +MCH+-+V<9AIT/?=5BD",4O]@J51YR(+B0K0V%F][,RERW?1TA5S;+E%F4; +ME6%+%BBB(F!NX$9((QXO1(KT%PE_ +MI;__4%WVL4V<=QR_Y_&=[\Z)S^<[QS[?.2]^3W*Q+R^V$SLVF(PLO(1`A@ID +MPQ!@T*3`0B((+6PMHH,N4L>0TA$H'4M5M**IB+5=U0`JM%UI*1`8[Q+M8!IM +M04#6M:)A#'S=<^>$%%F)[5^>/^*OG]_W^_DFQ10*'V2SN9Q):H]D$N@!\QV& +MS`(;QVLNSB*,EED\B8U'CRYE&.A2YB35Y=0ES&&TNZ=A444`O`7?-S7W@(/M +M4^(/-S)BV7-J);P0,;3.-ISH]!.1AZ_")1UM="3"QA8]F($W/?Q\47`RD<-F +MQ,T-B/_^@]XP6!%6C`VDE^^2#N.'J6/6$SQ!XR1%L4:!EHB;V"WB!G4C_[[E +MGO4>/^JX[Z0IC")(BLPWLD8;+="N`>L`O].Y4SK$'K*]([SC8HU*D8%1['2Q +MH;B8$T<-]TUPON%)`S0LY'2\:%!FL +M.^/C8U$6>CT&K4-P-5B.8]SC'.?%L7GAO[U^E(=.O/! +MB5.@`;B`]:5_@R;0K-[NO_UUO_HUL?+XL/J>^M[P\<].`Q]H.'/N$;_@)]$> +MFU#Z[DIGIH,%H%-<5]!K[Q6W(K3=*GY!F%;`'?:=XBWXA3`*[MI)IBY/\K;Y +MD&_Q;=ZB.LGC\S)%+J_%:')524\5FX"IR>3AC8K-QJ-_GS(L['(<=5Q#)JLS +M'%TT:&$>9[B,!G$ZPG'Q7B4C9#7:U5Q+MUR=;&L?-03P:-U*<*U$,./[!4^G +MEBS:DHJJIN6-/_XY[`=&8%VY,7/H7;1H\^"[P4G#+[Y16)Z]DMU$-JTV]*U- +MY47^?&;YF[$`JV[6UFR"YUY#>I1@,K8_G6GC7^`&S`:C>:L9&NKT=<'K)-KG +ME>JD8I_7((DE>%#FG(+C*1[P?(H3!*=3X@2)=S"\771ROLT6_:@8(%5 +M<)/:M6HF'H''5GZXOG%=F9*]AW1K^OXZ+A+;L#B6P+Y)!QS^I_,WF)]AD'K< +MOOS+>;>8&]PHET=S&SB8KI/BRX%4CF%#$+X53T>'@#G-EH?33DE<[I+*)?24 +MMFO#F>7F4IGUFSQDE`0)#_"30/:`4K_9A./%"F_`E3"=,"02K"0M_CT)R#NL +MK,A=LD$6DW&LZF4/\-Q1V"X6LL[ZY!"`;[O[/D5&U'(W,VLD>O'# +M:H6<*9/1EU%7%TN)=T3A[BG`ID1$.H*(L?KDHY&QB2CDC(NO*0)CO54!B'VB +M$00^XRR40T9D8,5`+[S0[4&G]"GI!4WUU=>VO]@[J>R76SYN;;U\M?N\Q2-2 +MJ7C9F9[]1O)STWJ901Z1*!K@??@*M?_OUWLQWM +MO]T!\*G!$K5A]S^[6Y=45BUNKIFT]D^[U1&'8,$)OX?8B_(:76^"1O?:@;V6 +MKEY`=!*]M@$;WEZ[!\M,O[@1/>,2&3F +M&CR&RW,^RV7D93TC_5@`VYSV=4K'"R&+L6"Z:9ZTUW2X\,M"$BTSZF6.IB=.2S^MUUTG^-J_;P>"XG^X:%2X`@XW8PX)9QS`H>5?*4X,EK@U +M*RL-3N0?^BCC]PDMLB.>XT;M0X$<&SCL&A-'?Y!O8[:>&_GAQ?5S_#\Z05]YU'LD_2Z_]+`Z!0Q$=AE9V5`+/>6 +M^Q)LPFJB3:809ZY0PHKDT"II\J"?K$Y@&A1H#Y8D9#;Y^&]*)L8!09<0F1E?P\<"09T4 +M)B;(_R;`G`0Z>@'M#-PTH]9H'+'>AJE\1^TTN&E!O9F]R%PS4K(X':Q7Q)!3 +M71%3]S%J7UR=[:I#5RI"NJK-7CX;@0N(-VR^(L2_I%!NBE=G5\-7N3)GG,]' +M8$9:BYL?A`SO/TSCYULKJ.I9RQ9(UI'Q,BZ.Q]W;\[;G +M[V#Z+;124EQ='>)XPAC&<5L);\-M86!#=,/U<6`#!R0.Y'&`&^2,"F'#C>A4 +M==AMY&S%%$87BOFTY))0-?`%ZS!,2L0#?DK[&^XR:$SW"=498,@%3C2FQW700&H-2;OP!6YWBZQEG,>AGKJ]RE?!TFA@_H.Z.WND.T:A:D*9@Y9H`#1W;(FV^6.V_(A^__O4 +MD["#6(V9L<:TCSQR'3[OH4Y?-S_O)2DS!*R9LS@<(DG]#)UU,I9S[J\.@KV8 +M'A#)68A@6QJ73_U*8UB4!+.T)>:M[@(]/FWV>E#P?Z;+!;:)^X[C][_S^W$^ +MV_>P?8X?=WZ><6PGL4V>OI#B/"`TT#AIG(526K*8KJ+N:)CH0*$/(@H3=.O& +MH*@=L"*%T15H20E[15.A(+:.K:B3I@*;@*Z:Y'6B]`78W?_.AE:R=/+)TE__ +MG[^_[_?SW0:N3(TD/-E?5LZK#G2E\K>NMD=[Y',7P7.]\KE=(J=\[RKR+*?Z +M_57]L[Q2A>@)1#[68#".JI3RL2?!D\<.UHZ%IQ*U8^^=FI22!7I#!"2]YD4' +MLYY8?@I@2FDT<)A`" +MF!)V":AP$GU8Q+LTHNCDUHE_$:^(F'@277VL:Q'DW+&+EX@R<7.L6+YV07*# +MHJWJDVVP+Y0R=]%/]@CX&6540W+@#^&@22,$I=4'XJGH-1FVJ4 +M>*?69!GX8YZ#@I2?@20`GT9LWA4=A?9`Y?M`!YS]J]/=&HT!-_LI``/<`(F?HYL2>G +MR9';J%GF#'F&.LM<)S\CM5[29XO4C6O&R7%J`PQB#<$#-^_B6WEGG=%M9WV?4J<2<-:"F#M7[<*+A$-W"?1%=5$7KL&X:&<\Q4N1#(^'RW +MHOJDS+E+T'84KF=C@X4B$3B@H)J78P>\:?$-%H;[GUAT?SR\9/CU]RN?GEVQ +M.;V_KCZSTY>]?'[_QP]3Y8\4^\NEF"U2N7&Z4BF)3>L5E\2HMD'*6N'K?V%K +MH?ZDK-TMY@)4Q!/V84/FO"?O'>*'?&L]:[V_I4YY3I/G/+=X`^D<\H[RX]Y# +MI-+@!0&U@Z4U1N(-)5`J:8*`2J-[W?I``.642AW:*3J\G["`A0.8#5G%=9#K +M)%E)J0OO#>_N..>X>0FF3$U253G%QN`(X$=24G%,;A&T+!D)S^ZA,&F1TK@F +M&S39A#3RZ(N_6](2K$NC=H?WH8&?;UG>S#4$'MW:/7#Z%M!>JL?.;7XDN\*O<6]S[Q)GN+]S'W'_"7_! +MW0ZS!,QLWN68XIV\V^4Y"7`QP+N="@P%"I[V.2D%4*IPVNQ`5(-F-3X8"O%Z +M_FE:8)UP'=^,ZL2(-*SH`JEK$I^WE:\C4M6J*861E`)C]P)"?%:Z`V3%R'LG +M.P[/U?P;L4@[QE2916X3.%`G:RN&9@OYOL>#%.DO5.+_/K`\$VQM6PGFXMDC +MCVYNB2]]\&>7AR=MX(9]]>[E+[TR\"(Z#.PA6P?8T.]7--P>%Q.JF-G,3[?5 +MU5?^(7$+AM1#+WL$:LD!TY1#-H@9FO0#P99#.]C)Y3KRYVIOV^X>,=@2>VC3\L+NRI=H'&U:-M"J^!'Z1Z!R=V'7H53,MYX827=BJ?0T+PKNDS.J#1:?4VG5W?HE,B(2*$!A`L +MC;A"K3Z,5X88UN)A_0;@53[A<:M5JE!0!_T76N\:44N97"87+VBP.705$H[= +M@??Y$[S7'8FRJV&?*1&;WK.998^`<'77(.3NR"<;DTV2-=#WG+5F&>9&JM8A +MG9GTY&0T=WWC3'=K(AOU40VIX\?;"^5W$\KZ7G1O?NG.[QQ9-]J<%:/<$HT= +M;UE5^2)?WKXVKDX@"B16&<;>A_^K`6&1022'?"4>,K&XTU"GCZC22+^;=3F= +M=6R$3A/]SS<9LZ&AT'#?FM!D:&MDZX(=Z6T+7PH=BAQL.IP^O/"MIKGTE^H; +ML&5YXC93;X_;I<@R79D.;#&DCI97&9!A0(P!)DCJI2RW&/.WQ+4M`U&M/ZHV +M^0=,.74NEPJZ44'EL>Z"`EF:79H:5LVO2H'4<.?KW3PGL%L&.PWSOQ".PE0; +M'HJ]\\%8Z29,K\FR;1EANSAFZZ\&ENW2F+0^YIJ(RE7`+6VZ;+M6NELD+57L +MLC3_,-;N^'-UO9!O&S):+03PBU=*ND`JG90K)'S6`SG>:`:"AQ1X\L+QU3QD +M8.64Y4E6$P]&79YTY?I;VON6IS9,3SW9M_W^BLN= +M-3T6;C29=%B\?M<8CC.V2,_01ALN[%NW8]9I>CPXT3[?'4"5K#/HYA0HAJ+N +MMI?/+@DZ8T7%;)6%90\,(?/B1DI/>5`]K6=0+:UE5`%5T$[;&3I`!\-TF,G3 +M>:9`%YB)P$1P#[V'F:%GF#EZCJ$)C9MB@Q@==/!6YMXB*'B7II4WIUU4BO(^X_C][LX^O^?\=K;/SOE\E[-]ML^OY$)L)[DXKT#+ +M8`1(LAK:4E)`3&O0R$JJ51&"M85J=*/-$)I4D(!-2RNAP3I`:&\J`3:*F$3H +MT*96&B1C52.A*8NT0=S][FR2H&J6XOA^R1]^OL_S^SS?KP$8%!2X]0&_2:>P +M9F#F2`;6?I[RQ.RD2H3ZE!I2[T,3IIH%.+!E;7IAP>1ME02.97E%U,K!6\!4ORZF+EA@JV3./I[7RJCV?PWL +M?Q+YN?+JF]Y/32AEH,-4@I+$H,A&!#$<240D69##B6QH2AL+; +M$]NE0_Q;#>\FWI6N^O[A"XR'QR-HU!N-A&F?UVPRN!"",2!V%^/0)]AZ#&&8 +MI,EK]F'.J!/^"Q8]P@`F;8J*,:WE,)O>J,"D0]X9AB'H=BT%+7B*;9"("^JC +M83D(JU4#-=D\B9-UH!9MJH<8X:YV6Y9BS6`,X!Y74PG\NDTHM;X/WK90C@J7 +M$.VA/TA<=\6;L<8[<6=[U)I]_$.@\XB6H$N?2AEL=.O)A<_M9BR301U.$Y\" +MSNR#KJ0QH^V$:O]W('5(GQ+5$Q:`P)M@0]7YKY.U^9=Y4Q-C@^\XAM49D#J; +M29WT\T83G'.UVZ36[1FUT[!`&"7BNC+20MZ&<3"37E;GLD(.)%8N_[J/NCIC +M-FT>M>^CWX]=13K`B\IO+X8NREW+X1&B"F\A.Y/#1T"@WFAW-'0X=Y@YG +M#^>.AXYSQ[/'[V[M*NT"YN5W97SFP,&3ECUIC#9:M,]5B[ +MJ8["9OL5RQ7WE&7*/54P#X8&N<'L8`XGC4$6#:4%*5N26T%[+LWA"`Y%Z"@T +MZ'C&"`TSS[`R7VQUNB2YM2A+0L"LPXVN#C8/\JOJ7$.L",157F\=8=1WE+*9 +M$&OJ4F.*SQ^(A7L1@170LP)("6E!$8X()P2=<`$T*'1O0HHU]2(R*Z-G99"2 +MT[(B'Y%/R#H9_OFC7A/7&M/AJLJ=JLKW1^;+Y>$1*/?BA_L:62!;VM0L69XA +M9\M/`--<8XRGV%*%S")HX&H85M=&T]+E+(Q%?.8`%?"HD-]L&Z`&/$.VW=1NS[A-Q?P' +MU`>>R]1ESW7JNL=KH2P>5.4]&J%X^FNPUYC'7:!^/I6X\5FE?@4VIN3VM+;`?5?1]_/$BZ8>?(H#[_Y">J)X`B/IX"1S( +M_.2Y`S]:0OV`5V4]ZE%I#WF8AGJN?N'-B8J]*THLP?[92%4YJ!B&2#`[78>? +MS(@/>MX1I4<$`B80HA'_A><+?%H_;?H//J^?-Q$P+E+[;/O($=<(I=]LVF7; +M26+]2#^^68^YH?VM$PQFFJ!IG7F3`S@4G9J7`@,^X%/,JO$-^.'BFRV3\^HH +M/K&]JA^!+U!V(+DLHF5"I!%?LB?0:C@E0%S]$\"^0FY>J_P72!2_8UMK^]8= +MO.&-F^I.#`[?!G+;#A,H@KE9HA1O@]\KK+IJO +MCX>^9=E8OY&9]$WZKX6FV.GZ:>8>^T5HKKY.7P^(^@C=3/?2_?1VW5#]$/,# +MW4_-X_7CC(6D@A*9Q.R\C4D6&AP\0Q5XL8F1QGC1;#(:=%C$+G+)L-=A-NBL +M^KX`0>FM?9PY*=DV8P!3CL!A@6(HIK2'B\0>A9K8 +M/=J%!+756+/(P^6&ID4[[*)R8&E,:A?3A:HN+.)6C1D<#W0RXE9>+$&I%FZ6 +MTI("WHA%>U\Y.35]JF]--`X`T;5^X=;&H^N/G?WS=^F*C=E:D8E4.ZY3)&/V +MC>Y0_E\//Z_\-4.G/SQD7U_4Q50].Z&>/9#!5GC+CBE;>7Y +M/:R'%0(4'&07CEGU@ILDK'V".>"W86R,\JCI,694HNKHJ)X)IL>YJF.",A47 +MH$Q[:CK!*%$-CL/+DN-3P;$IM^P6:2$*;43WK.U:_9UUWMAHA7I\\^4U8N9D +M(%E:^&Q+BQ1[9N"7-[_YDA.E6[<]./.S@5/H\\`=\^;V/BJTY(C,"MVSFT!0 +M\B6`^S?J;A)@?MH&=6&1MY4-/)FWG"$_(B?).^0,.4\:=!80#)(LRAHQ'F'8 +M)WO#/\($+_$^RHW9_9B?]9EUF,>ED#`QK++!7<$&37::,W%^R'DX*XKQ>6Z, +MN\5A7"AUHZS9QYF:A](&9MF\D,5RU>1#DK2!IU"B6:LE1`N%)(I"MWBP?:RO +M;7M/<_M6I[BAT+_P68:(%8NHI,+XY,:7UJ\MKAW=OJ7R_:&<(:/.P8JO[J$/ +MX+UJ1O+(/27F=M#2)O.XY7QB,C&3^'?"8+6C"=$A2$/F:[;)R&1T4KPCFMZ! +M0ET`?S_7?$YIO`",OPHEW_<#_P6P\QQ]3J'@B;(AY!1,*!X4G`0N),UY(I^G +M20N!<:A)X`C%Q]#G`DRHU]_:\R4!B/U(?"S^3AR+%Y653#-@0LTS8DXSM$"=V8RC$"2]!F]U":*`M +M`8)V$12T6;%MM]M6;&A_M-JB;2E];+?=(J&M1+5=I2PK4152M$7I`S6E4@7= +MM@MH?Y15?P#22HG=,[:#J%2$^J<39WSFG&LG]WSG?N<[Y.V&-JK?(GY`N5$, +M357:/5$NP^,\&KX#;\,+CG>AD:P9RTE(H-#O"`38?"X4%X,- +MKEXETZTI4#0BR8(UN3%_Z9(OF$WV1_HZ[&U?'.V?)I\HJF9??N\SM=,3RR?3 +M;9FBK8P7)B/YKQ(G6S-'_3W7!JBK#CA1;U5&3!5O]&WDB9*OQ!-NAE551E6' +MVM:W;6?V,Z>8,\QY9BY\.7PM?#OL%WBA@S#C7#S&GX_K\5A'?SPX),0#L>`Y +MS%<2#<5`>/:(O"U%@T*GLZF^6?R+'#/YRM%C,2$G%`(-\=5 +M):`]EF%2DJHJ*L.%H1(4+`3(]IBDTXKL&6WX*%UZ4R*D<_A>A9-57>E5WE1( +M!1Y_/J8[5'-M9GFR>&-Y4B[..'3CS"QP2BA&2`LE@8&;4Q#"7TH8=NB,)(%< +MX,'8`GO&<3*+N^!5((S^57[7*>%KG&]P%>[OSJNUN?Q]K2\2U5/D69L(&FR: +MJSV+=ZIY?UK&MDU:Y:4_$;LJAPK]49>]LE?J%.PU!S7\-I9P@-(XDX]+DA0( +MJ9JIQ>5N-9M(=5E%MM\]H(VP(]HX.^F>R.Q3CV:/J[.IX]EO11%*MBKJ.0RUN7%^?%XDS9FE1FBMH5S9**9>V&"+IG!%*C%!:,#%2G' +MO6&Y=A!O99X*17G*M@E)\W<9M9?P+">Q:W6T,T"Z7[C+PX#JC:C[I?=(WT361G/).^8Z99]0SVH*Z +MH`D!T0P&JY)NZ*))T@'#T$U3I$G:SML`AV&*>5NW+2:?KTHD21N!0-!\V7K- +M(JR49(JF#2N9E\6?B(28DAB+T8.,&##(O&72MI=#/C5*W,64M.Y.4TK(<[RR?34\* +M;*G$9*GTI"+,EDK@XM,"NT@M,NP\`['FO<2PT*LHB,PW>PTT;>>%'T;N`6S` +M(`R)&_+.43+0CQR$P1MJ]/-H;FQ#^UZC]J&>Z"105=F?W&OW#>!M"35K7,6] +MGHA<"Z3MD#?B'Y!7ZQ_-Y6JG+=;>D3B>PB?Z%,"1?D6^%;\KWP/=E+4;Y +M'\^WZ3T0S[!!0DYTD\%85X@FW..]?)YQPOG\@P7)$$KB9'\N5+`NEZ[/-X;; +MHE6VX%*<;KXPO`)&TP=G"-C*N3>`@6/3$(["%8?:G=2'&R*:"3:I>X6V'G5X +M>.Q0.3:V#O0-4T&_G8[D6F1&H-XRXWU5^`KG*P[@_F0N4OO=^-$O[?P,_MO% +M-8/)C"^\U?[F`UZS<=!@E/;:%/YL+",VB:^SNO2'?_QH]Y#K*N07A#?Y2-C2\IZ?3FNZ5-=YNM?[-P?Q-8FG+W +M0=>[,P/%?0=*WIE+&EF;S:9GOS"/FIYFW>8*.`&")V"$<$,;D#B%W[W\G62> +M)^[7NM]9.YTO&K57\F216/<];.27+E)F[F>UMV!G""HGC[Z,?HBNX"2>)DSB +M`CE%WG2]2+'43ZD:_2E&9RZP:]D%]S0WP+WAL3W_]+[A_<"7]'W`3_/_\G]= +MH(7GQ,.2(!T."(%MP>D0'3H=MN#Q^A"/D%\0I0`*PB"&%!4A#44@'H6Z +MUPTS#MHFT97L3J5[,EFKM\_.Y1__Q_\?EPN]`/U`DV@_>JY>AU4ZZFE$5T-T(_H8^D0C^FGT5+U>_WO]6GVQOE"_7/]U +M_5+]8OU7]5_6+]3?KI__CQ3^MXM\[/_(HKVM;R'A-*R`X@);;-DT6*:#K,L- +M'@58J6D3@,N&EDW"BNTMVP7VYUHV#?;W5V_9/+)V?7I\_X$]1S)K#CX]]7@' +MI&$+VHQ&T%JT'J71.*3I`-J#CD!B]J!]Z!GT-*3F\"-79=`:=!#6//I[_I<5 +MK:P4T"[8VS'(&`&("F@("O1]]U7PX14<]G^#?7[7O\5O\Y51D`/,/VSHG06C +M_[_]%\Y^B[4/R.6$J0<(,`#L\+C)#0UE;F1S=')E86T-96YD;V)J#34@,"!O +M8FH\/"]3=&5M5B`Q,S,O1F]N=$YA;64O05!.1D1**U1I;65S+4)O;&0O1F]N +M=$9I;&4R(#0@,"!2+T9L86=S(#(V,C$W."]$97-C96YT("TR-3`O1F]N=$)" +M;WA;+3$V."`M,C$X(#$P,#`@.3,U72]!&`G`F51E!"#KB+(1&Y0(0[QL$[DL`E +M$A-K)@-(((,B](!"_<4IE-(B.HK-@I&Y`$)JL5BE(V.'0ID"K<#HB$QM!W]: +MZFV?W2`5]YWW>_]_OO?[]O8@``Q!-Q0$&EKC[1N/7'D&F'<4$+L:.COTGU=6 +M3J;'<4#-7]R^I%5N_KJ5_"?$XB5+ER^^'"_8#V11#L423?'&*T^<_PB(GF9, +M>8**(:,&]0">+,JC$ZT=R]3.P3,I3Z1\=6E;0_S2F"\7L%XUY96M\67MFI<>`R'KV*GZ>F`;4N_9?U9&<7H7AMENG(*BI&/+FQEYBZ< +MPX^0#1\NB*F4>W$"YW$?%N`H:O":N!=)W(_):!45&"T^1#E"^`4.,V(YVNA; +MA9_!RZ@#UMO4E>,UI/`E/"A`!2+,LA$O6D?Q2WR"+ZR=UJ>X$VOI<=+Z"*4\ +M@8V0R$41<[:@7?AEA[4.4UEO*P[@G+C=FHK;,!%3$,02)-"*1_`D;6_A)$Z) +M?.[&CS+6J<)\;,`S>`$F?B\*Q>-BN^JQ$E8+YK&#%L8]S=V +M9$0K5G(G6_$.WB><9U6?*!PRD_.N(,QF_X^Q +MTRUXCC-\!:\3?H<_8588K`;7.U6FMMGJLP]8'/!$7AG+^M83[ +MT(%E6(^?L-^GL1]OXS3/ZG-\(]PB2V2SAUYQ5ER6D,/E6&9[3VE3DDJ/"G6; +M>M8UU;4NO3M]T5IB/6>];WW-W4NX.7L?[B),8HU*U&$NHFCDK!]V[L>+Z,%> +M]'%V)W$&9_$-TF(4]WF7F"X6B!7BU^*H."Z^DE)FR4+6'"O7R1V$?GED&].=Z97I0U:M]8*UQ^IG +M-UYV8Y]I-69RMW6HYPDNQ@IGUDG[+K&?-_`F83^[.HA#?$M/X.^XRCOW7\[! +MX\PAAY,H$Y/%%#&5?L!U[R,G(S) +M&9T9NS+><#_L?MU]!OLXX]]P3]]]&K!%2%2E0$C*J8KI9'#/58J.ZVF_+1IR*^'<4,5.GJNIF'U./ +M.6[ZS9X!>B[^GF=@P#-PPU-DZ5,PQ5^BAPS=_&/0T%-B05V$_*:@$=7-*PX_ +MR^&W.+Q&WNME@![*201U4\3TD%G5F4B&8D&FZPMP8(/\);P8G,1@.[&)&?&N +M1`Z)[1$RD`E@4L[GX@Q%3B4=-&;-K#!]O9AM!,WO%I9S_ +MB]]RH8W?,9JRJ"K>E*SB:#94#X@Q6XIOI%0[5V=:N38:,<7:Z$`33N\#NV@R +M0K8FUJ*;'F.ZD4BVQ#ASS(GLRPWDAHQX,&HB'-DW,C#2$?PE?3FK[O%R*'W^ +M:?YI-KW'F[-J@'[\Q(#^P_[!CM_1OY'6SKDQ%V%7,F:R35-O<(H8['62O31- +M0K)A$MWX1`5WV6QZ9L2267(7X:30EK;0K!@CY^892'%M+LLZ]#G)F8U*OTA,\<+7(H30T):.EW,[<2#/7^HC7#$3S;K!- +MT>C=S#/>SJ,Z>9)19FBYGJ'%R<`$W]"II*26(RH.1^HB9GS9/XY,Z4"6N+V^/5Z^-/P_E($T +M&>V=="R]QWW0UMST5+B.P2O)R%>QD%A.?@UIF'2=G`Q5I0_I2^Z%Z*/O*-<\ +M&,0[[3CU`K+5QY!-?H*3YU5X28O\AUT-.8H>T +MT>96VD`B8\`_B#8-64@Q$!JXC8>3$WLQO&8289` +M.TY=.W&FF+HF8\_$3N((V?'(3IJTM=NQQW8GF;9).G%2)Z4DGI3D#SNT=8SH +MNQ.QFQG^Z/1&VK=ZOW?O_7;?[MN5=K]VGQ9E0??T/LW^?:#[ZI1?X*I3^.9K +M0<[M*>=2>"S9Y@'Q9++M):XZ%P^C$@6&$>U!)80D=Z&8+'=BGRQW8)^,/Y84 +M2N"UP63D,(B!9&0:IF,+\LK@(\G@-&A7)MNZN.HL'%ST&4`Q1I(KDI$#`+N2 +MGJMC1%X#/YBAB,),F%I=>37&DF>,`K#\\?:>;<,#S%&<[5YN=L$!*+*[CU +MWZ,?I-?3(;J,]M$.NI@NI`MH(Z-G6":'R694#,,H&04#ZY8QIA:NBVZI8!F5 +MK"24"JE5R'V6D%HB4\\(S!"PM*3S(H'WY@U%S5%]1!>NBRW1="^V[J6>@L1! +MJ)6)$P7MB8#462AH;TJ428?S6?PI_GL\=A;/2*(=?O/XTWBKK.=C[>WFID3S +MVHTI/!/O3P'0#W`&SF"0DLVDDR&8",2V;797,ID9+XK&IDA+9A/*B4=EDE/)*)C#A&>8^ +M>#4V)0BRE2J!?3)OGRHA.RJ0'06#8!()2B93@2`83`4#,BS<@ST9N#4#M\IP +MQSW8FX&/9.`C`"\YQ__'TU?SO]F=ZC@T/"'=EKKM\3[X=B=^,@07PCV;BHJF +MA@\M7J,`XQ(\(L6*2['B4JP1<42. +M)8TMWO]`S>`2SP^W;^\:'.R"30#_IQ#U/-4$%9]&M:<)W$@I8;N+^4A!-Y)( +M12D:29*P9BGI1HPL3-;G?%VKV>U>?:NR9;YR-3M7V<+.5Z)HY7PE>PL:OR^H +MXW5.^/+44.KKVU33[==2Y`=WBN4]UY4^0&RE-B,=BHOYV1H%J6&R#0I%MH;4 +M:0P&D\FJ.,DTZ"QZ0PJK3_%/9@*US-]:'>^+S:!H5!\.8YT^#`)=8B_Y?7I# +M>MZ>\])PV1\IW?==>OC/YTENS`]N8G?L_./Z/I +M]P_P%2_C`BC;,I]RX%,/?(SH?K$HB\!:EE;"AU1K::V2U2D-><#)V*`^J;7D +MYLF<6C9D.-V:_S8G4QBQ,B74B0@:*-'.\E"YCG42SE">2:\CZEQSV8.X/Q`7YC,OU%^F7@]E[Z&IZ# +M?ZX&X.:XJ,`DP9`$J=00),,>I-6YP.R72JQT&RYH+,;<"_R.16;SNV:WF1?) +MM5[W;E,'2H]+[FGHW`92U^AJ@G$S_!:ZC-3((1HHEUJM`>:,B[!D:\[S.YY9 +M)'V7L-^G^(:846G'A36U@E!3[3-+HD80:F6?BH6/"`'R1J*(:$8DN49/$)@@ +MX;!!)*%>9'<.NQ"/7YSZ!82P2`3-L$RCE1@2]G2+U_T$^SN8D2"VX\N]Z8J' +MJ#C,M6+EJ&4V%RLA\O+H[C?0/82![5SVCFC@M(JC;G:8J/"S1AA +M[V"S1:7&:A5)(BMIMN@L9K4*4TJC*^0J6*:8UJC*4 +MI?QH^NWTX][V[/0-:;\0Z-C"EWB,?`5R:4)E8C[A8FB=RZ2V2+O$E:-V452. +MQ6PYS]_9NE@BV%GV7FJCD%RDM-]=>,1_)_JIN,<7$;V>^.%J41#J:D*D)AKS +M>*NCPIU$C;"BMMKKJ9,YI!;^IGP.A-<7O8'LMZMFC2-^F?#$P&+SLN +M"5GFG+Q0<5YQ**PJ"]75QQI^K!H)C:O4A2Z"86R>5YUXC1-'G=A99B-L5BV/ +M^7K>65$K5M@,J-96U*1N\*RD7&ZRT%]8Z%?[/>KZY9[E*Z,K;@5R68I$+H +M[(3.O*22Z@3N1'G!@%[.%)%+.!TZ-E3.%YFD;-EM3H6IF^,C;_Q9N_P48<_O#:\T?^?3&=J/&45CT\/GP<+VLLZSO1_]W]Q4:+ +M"ZM__?GMLQ?3?TW?/#:1[^H*=[="CDA4"&?*,:H'LE4$6[!2/$%J2=9"6A1Z +MK9Y=QBTKQ8\>7Y!Z!+"7TPMW1 +M'1PWKMH=%,JM0X5I6PQ!X^[_=W)75G6:%?\?EJWH__'W]_U_K3N*1-%6 +M=)1BI?B@:Y#=0^RQ[29W4MO=V^GMGNW,GMB>^"@Q:MOGWD?O\^QC1F.C\62W +MNYO&G3#N86PH!'".@VN!P"I[!$;CH2KM4XJ.I2"5I**8(VP5K)6VP4,8NVJ%UTUK!# +MEX$]9PT,].;ASQ)%#JN"'',#M?!$@UV,?>N;I5U,R`N\#=XQ+H$KABM+,I*;5S)) +MK\0',[*0TBFFB11:[=Y4IJVW]>M_LH/3=F"W*\%,%I9Z4S:95$CX*=->]H7O +MP0?*\4?BDW$BGF^A="\S@1.OY-MSIU""8,X.59$SEIAJ1PE56&ZH4KOH+1;K +M])!%%@W#LL5XNEF260X#AII0FUE]$&`R/@C27&80`*EIT')&>'P7'JC>DO-0 +ML:5!RAL(M=LA2&]>3@M]Y$TCKBIL>/_'^MP_4UN*3W8\^]<7]9?&-)0^_/+X-F/C]1C0QMO?#53G\>JST[*_*9@EV`G<<4CT#L0G<_HJJ0)95QARZ"/%A'1;(>G3"(@NN1+AI +MJ+C(@BH7@:!1,$!;3#3A]@J*I'JCG@+F3L"&$7T%C(XW%<`LQQG7FE=H]\LJ +M@H1Y&6A0A7H.D^,-%TL0ZZ[20MYE^'-ZY[9S?S"O@]@?QW;VK5:[UXV?-%\] +M=NBU*=#AM-_?&4^8^<<&GC/'S;=A\#FRU%BA+E^XX?=O@"0P?GNND4^W0DW2 +MD-,SY;8I'KQ$3I`3D?BDEO1+/*O)/C_NRG(8]54*Z^41<<=;F#5B)4);`"ZU]'S[[MS=? +M,O^ZJ-7X@&L+ +M+3P=X3UA$,X(A(3QFI:T23RIR8&G61[C`)<)"`&:",>2%*>D7$123=C\-.E1 +M#R:RFB=+!OS-@BAJ.@F%J.M$F!NF>EW#F-JOXNH$[CIL^&*ZC4`PC70#YLVA +MZ>GIDB6V#M2A:U6F6FWD&:0]JX#K4?3&$*A>,XQZWYBB=%J8I>:7LT"V2*+8 +MTNZUIJAJT8R0`%OIZMQD*SOSD:_^TKR:"8+YVWM"+2ULSZ/F\;[7S[RUK#AT +MZV5\M6(!7-]%JN;YW?V"9A:^,&*J(WVF?4'HWH/FSR!"*_,AGFO@)(GM+Z_Z +M3(Q+,*2R3V.,2;RLR7681$Q,0HRS_&023\IDF/LWU=OBZG>=<1$N!$^=A3>K +MQ)M#?1`>"J!C2(R_@?N/X_++A;L)OG0TY=SF)P^(!Y16>!-LOIG47# +MM6.*NV,',5(']'AO5)\%5*YT4(J5MUH_OF!_'OI4#FO!)LO\91QHI/PP+[Z8 +M"$N\H,FW&Y6SW%HWJIPBAPD?I)!JRK;DH%FE*.<:.0*W'6KS#!C(M]I:+=^Z.32$1`3W5.9BW;T0&)2*%T2N(=,"<%!%-M:H +MVJB6=7MU):-Z-61>661>:61>S?]M7I]E7?,^`1E$$:&[%!BF0DP5LWVP03#6B5J +M-`X84RNWX8&1PRO=-K8DA@*)MR$WZ:$2!%.L=./KH;45*UU=E=K4YOFU?=VP +MKVMM0R>IJF3G!K,"]LZ,/ZIL[("1I*F\`_S`7+6Q#)5G^3[^'\H: +M`I-)(#OS9RP8&9F6>!]LW3;"YD +MF,LYZPL0*:FOOKQ/+$$^+YZ'GQ&O]!]`/QDGXI?4.=UD/Y.:5H,9W/VDC= +M+_AU1<@+O7R7X'3HCG007@BF[;]H!VE=UWV"P0M1AJ:;?48ZBAM1.(=7C+0N +M1'F&)IV8*\@13CY$XG(.^P_=90/;Q'F'\?>]#]_YSG;.=N*S[\YV[NP[VW%B +MYP,2H$XY"(1`-FBGN,!4-Q3:%;32*%$)=)"6=D6H:"O;$"K3*B%:8!14P:"A +MH2ML*P18^%*EM%M)T;H)&$*V-JE1UXWXLO?.#D%=%RFGNXL5)<_[^_^?Y\&K +MQ7J9%H,UZ&>$B^>#"3G)+ZJ6Z^55,BZ;FZDIZ:I-6(@T-2)$BID,6C7]YZRP +M:D+1FD[[D7Y%/F-=RJ_2?HKF^`S!);ESZ`X549CK->L-BJZY;\C;W&(%,.N) +MLC^89V.0*HFO#F3:^K&.3>VG-_UI<1OF7]W[E+$9WMBV*E=\/9N)U1A;%J*] +M=5IE%KZ";^R9A_BQ+7C.>'Q?[Y4Y"4&3F3FKC1\7BSL7L1$5KPJ[VU/P\$/& +MZWVMC%K>\[8[Z+Q4M,G6W9;1'V%G;5*`Y:4$.YMMEQZ3GI%&["QC9UBVUB.* +M$F.W)SRA4#`D,CB@G)3H8!%H(,+CE:)/"D95LHK6)3E8%7?$W;ZX$(V'Z;@: +MQ]$O"$JD$!:%!.6YB^F3:U]BTJTU/)Y+H_<,I]O30L7!:0Q7Q(Y +M4_X`27%)`M4"$JE+FZT@!QY0U@Z_.8PP`MU6-9#YESK:M\#=\#H]ILVKU_$7:-;EM?GD13W3WW^H@G)JX=:I(= +MJI4Y)N^0AY!VJ-&!/?K\S_QP16!MX`9[UW6WZI9D8\UB%0CX`ZR?#A`T\'+( +M$SP,%@)BF/;;91GW^7E&8-UQ!UO+\YZX-:F.2"`<%VH)>[PZ;JD349`Z^7RF +MF$<"Y3-FK\I/A0@S7$R8NB`T32K1=RO"CR.3')$QD2L#%TM!I`MTHQ`_1=Y] +M12"21*J;.Q=VXU6-D"AQ+\79)$LFN55[H1;GT_3?87[,8VR6:YA<*FN:7 +M^RI7N!_:+7-K!$)`K=*@L$`HJD1"6Z,`ZZ!=H\ +M=(OE=W!JB;\,!Z%JG!J$T)@X/C1Y +MY^II6`FK3E\9/6-\:7QQY@_87KC:N`3K8"=>%$0D[&?AC$//H3"A)>Y94B+&IK*[(HE87 +M\2BAF!>GY%0HQ712BRB-QZT`']-H5Q$32DG^$3\?FXJ6/N< +M,V-F?QK%@8*[E#:3Y5P0"@19)\`<*M38H"L+L0"Z."4F"X"`9Z>3PIKH!357+D,MPF:0Y9Z!/];R[?-#;8H +MW$\?W35Q9,.<><]A$B1@I7'UMOQ,8-'FXEEB5[L62!;ODEA\\<6)I>RBE_"- +M/UQ@UT8.?/PA;OSD^8S=FK-68Q>YVV(K#OZBIU7_07;$]1'WD6\D>D4=I751E"6>3B'`/H`*4&!01X\Z'Y$Q/H*1K/0DV17V +M[O7^SGO-.^DE3?).U+!=<9.ZFD2Y*A9NFLJAB1(&+E_V"V#N5X6Y!>YS5!,% +MOR5F1HD!GQ938]$8;BOS&/T6'F-3//KX:2(!RJ^9:2C+K>G_,$GZS%F-*%$T +MR6FHF8#^#Y_LNQ-8>Z#AJ3Z]:=8(3#N7>_C=03P\:@\9_!LTTG +M.FLJ561"OR<=RY[^+4R#AUE#I/Q6D9-GY^P +M\2JIV7P(>,)/(>JAQ3SL-?$V';F,^#3;C;ROJM)&E0QZRIFQY[O?_L72EY?' +MC*W]<^;U8"V_Z?_BPA%X,+:TU3AI^/N0+5_`AK6V4\?G10(I@RJN9=NWXAN? +M;;-K==F;O]PO%/]=7VM3L7[26%_R8PQD)V_A!<1Z,VB!:5US1UY@-K,[V!V. +MOT=OJ50GO9+)JAC+4.IKS&O.[>H8,ZI2S6;-<,Y\45_9L*X!:]A7FQ+--V'A +M1?TQWP]\F&^?YHVK3H8@PJD6+TZD4G9]ACAS"*[3*X#8[.0858F+5$M`%-"[ +M04D,B2M0=6G2*UI$KC[YC^1D$D_.;EZA#,$M[P.NGL.XV;/2ET=S`X6;?FXT +MA_3][D#!/^X7"N.%M.5-J*YQZ$$H+6V4H3FA-9\S^\G]F]X^ZSAF5->1GJA+ +MR0)[`AT%68P.9TNS@Z:GM)2FNHP7 +M#0EJ+^;Q63,RV9%^ +MX^BR]/*KA]N'75J0KJEK:+SQ;-=`??W3[[VS<,&7I[NO540#1%TKO`7?W/&] +MG5MZGEJ2?F)]8].3&WYU=6%4-KXS_.::%&T$SQ8+?^L.TB+F)'X5$,^#.N&W1@6AF$,*\;V"!-NYTV;PH"S.F@`V@NCF.=<`C2NHNB$YZPN]N]UWW43;C1J^.@ +MDS^%V8$_/3X^GD/C,3Y^V[($L\K,G@U+XP`^S\!"'BV?'/KB"OF&>J]L2I2$ +M#X0F2YTXL8UMB/8<[T/)_\@K>M_AS>%&LM/8OW_-O3MF[%>9^=L(L/J`R:Z$ +M,L#;5I;4P,_UQ[-"EY@+_I?NDZ +MH6D/0:M)$VQBI1(2E`H8^0.4"JV=;SC73DJ+AJU[S_61K2.?[_?\?I_OMN`) +M]D1P3KH2N!MB9$IFNZ@N=I@:9K>*$])$8")X+G`N:"7Q!27:_7M(E&FW[]%# +M3"0BR8EHQ&\W&A79[4*8R;4QBA+F[;8,[]LUM81;%M.]WXZ'?3?_C]_M?QX7U]C-+*L80- +MOT?V(H0:]<&]PEX1^X5I849X)_A.Z(/@!Z&[[KL>AG$S'L$M>!+NA,=,,PQ% +M()M!ZQ!#N;.\:]3%L!XG!*705Z7ZPO),765$(%#HV'N+=,1W)\\R$M\MP=1&IO%5J@ +M`=R=E:*U8B3)B?.K>8>.>[XR8 +MHF2OF>6_4OO)7I?A08XQ(%'"*,P)"S=I(Z6+>7"MM*3PH0T+1R07D`O +MP"G'*6X.S<$9VWG'*]P9^8PRC^;ABN,*=TF^I+PMOZVT-U5T(I>1$B@14WG( +MY]6L)9W)9E,6"]-!/N5R;+&S5"J`A*9HE^2\*BB2?#;ED+@$&Y5B4U*W5$Z4 +MZAE9S*#"PO+T1::@ALE8?US,9<-Y-:CJ0EI2V6S&)8H2F\LER2B4"@5=6+I4 +M4&EC.9_+"JS%S$@I62SE4T1MDL5H2Z$LQP@EX(*:RS)K_'Y17H"1^3`20;P" +M:]%AQ,`;=4L8E0^7<5FHK%F`/UV,[-M)NN#&):+T6$/D&[KB_,;A+P[I!:+: +MU/PAU9V?(OS##VG="FF]Q>J_:7IB$?[?C2*FJ%(DKMFK=+7YX4@KNDV./^@3 +M=8Z!,D3C!HBR@,D<+-?$',M"XL8NJ2O:J-@: +MF_=#;^H3NIA$2I(XN\'03)PM#0FZ2O\K(M-"*;W1="HLK'[/&_$^MO5K4/_S +M\].[\=YM4M)C<;W_MZ*+S4BC<'MS=G1"^RT<[7O\T<;I)X9WOO>ODC?2&5JO +MQ61FY,?P35CW_H1140R,+=,6]XC:=1!KLL^5=3!$7\S'G]..-:[O4*UR`HMR +M^/M0U-X=#*E\QL6:9-*_LD3/GQ(]$RB)7JZO2]$5>E@(%QL +M1]L0_*I7?>1SVGMC,XUCLX/:TNR^37A!/QMBVA8/:Q5X-Z`P&;N^>8;VTG&M +MH$U.]U"R3`_.P!?@Z+5GC*U>-Z]=Q;O)OCG0<#U&O1Z#0^WTS9C]4)2B[8`X +MN\M)"A1%SSD<2."<'T:^=!G\J%F*JF-*)W3^5\\4ZR]I!V%9;(VG8T6&^_O[9-7QML +M'+@XLK3=CN9H2G!P'T86X,2K3Z\L35;F5I9>71DBI54Z2$,I`DO:IDL]/C9> +MO0`7M*ODY$5-GUVA/4:9RO5TLW5MC^ZG^2IQC._I3=?5@LB-U/H53"QC5+8-\7!IJ'S`. +MU1WK[ +MH@FK'R@LVQ2SXE+`3N2D>HU!Y(WY@R2JNA4N"/&$P8H4`&1WF/KH('+&/<'[ +M^`U-!%\)L,\]UTRPD^.KAUE'\5AWE]R*4\UB[B6L1;B[">8$PELTUM6MVY5, +MQUM#"?"&9S8DUOKA=ZHP+RF=J`^&N@^-X$34S+[6\:+AJVH]X0J_?KJ?N6,%LA9,VB-)P +MP[L)M<'QJ%FFHA')[&4-*-++4M)N)QLHZ^,BUF5EP33T" +M!\>3%$]Z1,!1&'Z<>NK)[3^9MTOSC=]9TNDJ^^5(WS?O +M35B?85_1GZ(OT1<=G +M]!<>/&V$F=TX:A@E5C.K[>.&K<0X,VXWAO2L`RA:W!@,)6ZKHEIY!T9KA8J$S1BN2IX$",J+,J-BZW +MC[`@P.*F1,3D@PM!>ZPB8N8;1(5^@%()!Z#=(/4RIU8^M>.I"3_#UMF40I(" +M.OZ;F"RD2;*!][5N?.'(WOO[8WDN5]RZ_Q=7@.Z/4>SHCCM\.3DFI^W,^[]\ +MYLH<:0F]9>X3US\\!YIJV"0@-C/:,>@1>>12:C6J0];$ +M'HE-Q)Z/'8Z\'GLK\MO8!Y&IV'O9RY%+L;]F35AD?A@5],:/-0L)SKB;]O#L +M0C?GV>-K2"KB1I\2YJ7N:G@CH4H"C?;;0;=1,OX-EP[\BA#RMO;AJ9Z-K^U.3/ +ML&,\$P0=[3$4\S&DD]2:T-6YK6VSYSI3`/6A9A_&M^G%R&_VH99MM +M&S-KNFYN6**_5S]"G]&\;YG6?&'XS*QOUQL(UH$9"-1`8#HV1V$`FX?I..Z' +M;BN^1_>2#M5U-AC=#A@,W=0Y`A`*>[W8)4J!WNNIL7?8DKLZ4^?O3%U?*[97(B6@<'.9E$5U84X/*#1H35A(F*G.?@?P$5CUJFG`(_AEIZJHZ\P +MV^G7B_P)G#0Z$IL +M:L8._>&-+Z?7KB(?_1O@3IX%@=Y5K8ON20SV0L\,(0A&02Z+R$.E3(8`>D,C +M$89@B%@1X<1/`[XB%_Q4P'Q:T6IWT)..I!%XM3F/&]?IQ""!>?@0")U`-26# +MR>V+XW$(X$EP$Y'BBN85IJX-YZAZA80)9F:&KFD?W)Z#.N-0,J(:$=.TD$ZF +MZII6F]\84&S"#9*,4(LNH='RX<.119<&)V2_N\E-FT3_?)?YQK?M.RK_YK3= +MZ]"=Y7UK_C*WS9<2HD[&W1?JG"E7MF\H&C@XLQJDM=J%O0OUS(KT($N1`>1\ +M:45O5T]YHNM'Y4,NK3:DS1C*SG*N/(H]F#UH.^@P=%JI6$\TXM381;\+%>=3 +MG2T&^(R%EQKZ82M#ER9[O.$%X5-A+#QO07+`R3?B:$?.-#`@VN?W[Q8/B*BH +M�YI$VV\D.Q]F[);CT!+I1,A9.+YU!VV;[;?L"NL2L>,308GZH,ST`RP6MJ +MN@(YI1!)X51Q"B(W=GEX3&%4O%*W\-I@J[^<8N$*C)::`\#(!^,=O!23M=3< +M5?D"LY-@9VOP2OZ:)_/*LZ;FP478GY1[1LWFMSPZB9U]9_S@^3M3/PTN\MM7 +M.LBX+*UZZU#OK_J9)5;RB(6@WSG0V.F^>VXL"\#R9ZK[?_W*Z61?%QEC0]T; +MK@4+*S:L#%K'[M)7_UO:=&<9MBB`H<"D+99:4>FYDFT=^Z.ZOAQ,]X^^B?9"O%LC7?T%OEI'C +M)7NW'7S+`@/K9%&GGHI[950H@*W&$60E#U##45U55;K71;4#%`%;,W,U`=V. +MZ'4C5U]8%B7=62/3$-W1.((6$X/WOM3&)^97%PRT="[[P9[4DNH\SMBV%CN= +M36-HH"&H]^"5YWK\A5T]FZOWCY8(CB/S:\'DBBWKZ:IU?9;D:AX&YQXU01R- +M,.,,ET2!-!=)+L@'!)YW\-1"EG/LX7@O9=9P0?TDBG!X,$!(:N+DC9-:RB18>>R!K,,M&IB5RM)O3HYD55:>VM:-=_7J#)M*;P2>=C6&-R6O*N4E< +M7VG9F->K>P)PRA'LIG8#DD4NE,;F!@;Y,>8)YB#S5>!_`5S#B[SH:^4SOB'; +MD'P?/RK_G"%\?G_.8O,+C$WPE_R++;Z$C4G(C&Q+)&3![X,)5?34*&-&/"Z. +MTR&M84SDLAF)8!+P.^869%1J<8](CTFG)4S*9Q3N&6V)>)8W?GP:BJ%"H'Q. +M\>C//X=9G)H>/J-:,PM;7-R!U$J=TNZNSLS2M;?P/:ZGG!$G58!W%<+;,IGZ +M'G(05#JHM#RUY)F`&;"0<)!`F=I+H"1J^*P9:9>;K1R][+Z>**[#`.-AFO/@ +MQ?6[?M]V\NG=_=6R0'.$H?JGI*>WZN/PEL785_-$%.4<+H=9:YA]\ZJ+)UD2 +MXSB\[UCKE1-;<2>'`M)DM)+@V>K3W="./!#[H,JG1Q#V_W27?6P3YQW'[[D7 +MGWU^._OL^'R^V'>VSV?';XG/+[%CQT?B."\D(927*(!!#/K""BJ96#8VL57: +M5KK^,1A3::%2"U)'NZ*MHFL+[(\J6J/"I*P"J>P%L6[38.O41?UCE#]&8_;< +MV0FPEW^>/#G'4N[[?)_O]_-#QE3!C6"#".\1PAV"TW(=+YEYRU&G`\=P^,>> +M#LH+??2VPYG&<,U!K.X@W3Y0@(D'K5-XT"[Y0F;%+%V-`;.K8A.]A]\CL?+V +M)L^;BANPJP/>+H-!#)*<-3'`_B)82?%,+A$A\50H4JWR>$ +M1DO\A!"R",04?*5C]L%17T$='1E4"_EDV.2%\"P:JVK^4)ZS1'UBHJ.J/#)^3K.R*-I0E=E +M75K/G+G;0&6M4B?H)7I)9PQ/&YC;C->:P1PIT&CT=&OPH(?Z +M`R0'O=,)M!_0(/\K?5HS&OF?CU:>B)-<5$ZZW;81^2V"0'<='7^\(KC'"CMV +MG=4R+&F]$FY#MG&L))\F/]'`6V4@1UDNRD8@ +MX'&R-W:_#!JS#]N["K13^3]EL'H:0!HN6I@^$V.+G=A.8MNRDQMKO7M+M>:F +MT9*ZN:\2S*M#S;7@!F_*;8,NYN!-#EDR`IRJ/@;.; +M9Z.>W/*5D1Z4ATIB2/;>GR$CO0$[@46\R#$U\8'IE@D]3I_H.$6?[?B<(CH0 +M%^[Q;*(VTD3)R"I>E'0J1K/77?.:"8C&[_KL-;L9F#4Z]G'MP<19U.$8LK$N +M1P+Q6"4+L$<0#^:.`(<)[A@2[FP(&P$=.%QHRAE!7`:XZ*6JFUGOS@8'+8NX +M76@HB.00#5"<.O.@H4)V^=('`/_B\GSS#I@I[3Y]9/_!D\;BAZ_]%&3*FH=,.A.>0RS010OJ3-Z4%X][3TAO2#^6;\J? +MRT9*(N0Q"3L3!D-A$#32@U9>N1Y.#?*9CT.LX-!+TFA]-:`-1,AL,#0N^GBY>;O["Y>YL7'TT90RW& +MZ('Z?@*9FX:T=E7=1,6Y>"&./9_X2>IB:C'U>_23U)T$.9$`O49ID!<_#OKT +M"XH9)2OK<6$^@Z?;)W6)$9<1PVDO2RG=)$O2_5UF4;`99"G-J3[@TV'-6GLE +M"9*:[718TVRG:?M?PCH4L$+0;5VC\33).*&0]K@U@IC3<#$Y#'[`N&P).H)8 +M4A14G*'\F@N!/H[%5T`NG'_@_FJL[(1I"H7V`W>[>?7;"X1&4=H-#0_Z>O_WI0Y#6.LX$Q3X'=8XASZKC"WY0 +M"()`#&BI%X/U-:C5EUG`JY!CCM'!@!^+A\-!6,8Q5R%HDV,;;@ELT;2M+/93H+'[=D\F1F/HU55%[I,A$1^BQJ4:3$8T] +M4^#]79L(7'1UF1B6HE^=V5U)Q7KKL^5F9?,@*K:\]L2])?17\"[W(!F`J2*# +M,*`#C5F+UBZP'S0)$+P+?7/H._NK7/XJ+3BE!&^!];*9P(*!DG22A=YHR=`Y]Q]SB4JQO79)!N +M&.E%^T69P$!R30]Y7*_@T#79.2.O#, +MUOU'HY2Y^?>=^=V;2]M&A@^=5BPB]";7G@N??AIB%;3:I?)`7Q!U(46 +M_4&#:A:I8;+?;E8IT1Q6_2(21-,N'ZLZ$BXXABW>X"YS-RH+++V\L`BW]&_@ +M@E27YS[BV,M<=7&Y#)6#9`S-Y@YA+OU="Q[2!K1HRSE"^BM#%^K&0TV+J)6M +MAW-!KB-[(#_7Y=E'$"9VJ#)K);"3(\OSX_)04.KPUTM[BH^BVS$#09E=Q>$7 +M<>L=S5O.>TO8-=B+<22!O*Y.KB77!K:06P+[R'V!@^1+Y$L!4\`:L*&=1JK$ +MVX10I,3'A9`+3E$,[SKJY;V13IHR$7$;8H`]V2^:$R0O4VE[(B'1=AH&V#O_ +M9KU:8^.XJO"],[/S6GMW=G9G9Q\S^YCUSGJ]C]F'U^NUU^F:N+'K)":-"W92 +M3`E1<0I-6R?@4*E"5GY@"R%4I"II48@PHOW#'U2E5BI5)6I=$TH%D0`31:EH +M452>`@F!4(EWAW-WUU6+%`(2LYI[C^X]6_QX=7`L-.^@)H8_ +M\=#;WPZY4PI56=5F>?GI#G/G'I$/Q(YP2]*BYY%]81^ +M1CCC_W)D55CUKT6>0\]AE>=X0:C)L(%YU<]QLW(DHD6FL>0B4 +M29X3!#\E7\8[&Y-JA$M0.I@O33Z=P)!J;RTL[P143^WMY6:@+?E;)%.#:HOH +M%>>`PHJO=SM28&'`!D1<#9-CLPT*J:DX3#84U%(F&<&7!S."\]JE7C7I-[%6 +MS*1;O^9%073QK9\F!X(%>CW*^@Q)UYJW\9OQ*6_*(]#1*%-;;!:\+M5#W3P2 +MD]EHIU8=L/_D^`;@,X+YQE=-SBS4E%JX%A\Q6('C7;R;]PF%@)$VSOA6?4** +M@N*2J5)5NLJPI4JH4*C)N4)8"VN5D$\!2GD>ZEABL;-R*5P!CUQN5C:,N)$K +M5$IATFST3BHL/,#40H6V +M$)*16`W73,W(47$S#B,O3<9,;(Y:6TL`,`'S;>GFPG)SJ6,O[RQTK&UR4M0_ +M`GB=DS8W,](F1U#?A.(6"EQB`?Y+9,=^F`&`N[Q+@)FB.QT(68<7A1RP85P% +MM_80?;D^TNO<>+%'RV=;P9C>NL*P;`_UF];[%.?HH5J_+,8L?"I?3`>2IRY1 +M&9^OG,?K]%DNE%)RD582OZ@]J"9#K*X[S,F=/PH\RU!6\^<.#OIWG\QP0&(P +MK2^-+[1NX;,]OI.97(+I\@BI#FC#>32*I<;+O^4P@QB,%.3': +MF$\L^U>95<>&MJ&_P;Z7DO=Q4^XI:5)EABK51$7D6;'"JKPH5OR*DF;ATU@U +MK?2GJPEHX1ZJ5L1J0JG)8KHF5\#M'/L\N\%NLXQJR0D6[FJB6JVD$ZHBLGQI +M!+ME>D23/*,T8G6K1(M=UHRD,]SCHR468`>.L)=FSYID^?`Y`BI74:E^BZ?NT21 +MZG.P&U%NC".8Y$;5;IP!?UR'^';"5/72A%%\PZQ4M,RH7APP\B'<^O_?^_+0_)-.:QEBI +M?[2>F,E3FD91`=D['JN&/V/`MR +MU>\V'CL:Q)RH!OH'TMEI82(\G?UD^$1V35S+/IM].?NKK&LJBU,9,9N!Z'!.HB:I +MX1=*@;S8^X=7Z-X^+8J]Z;2[]<;A'/SN:"RWZAY]BF=85HUS"-^GS4&Q_C(4(%DA)%*7IBW.:L>!?1M?H&UL +M0Q6I-]QHC$(A!Q5D'%^/7_IV().9N26]AZR#D,-@8)FV;^]@^_AQ\N00_+Z" +MWL(R+N"C>(WR4_/T`,,RKS@..6ZP9SF)>Y4_P%\4ED6?^"VGZ;S:L]*[QS7@ +MNN`VW-<]/L^._*R\[96]__0]I8C*-?\3_EOJU<"C@>W@,\%W0F^%E\-_UB[J +MA_5?1+X3I:(78MFX%/^;\8SQ@W;6B,DK(!^\-5@X!#>+[GKA;D_1"#$.ED.( +M[XX([59T]O2ZW))']L+*BE\-!$-A38]$8Y#B$+U`?4DSU9\>R&11+F\5BJ7R +M8&6H.EP;&?U/_UJ_^XO]ORX&K4$;@;J-1BX4@[K"0B4T@NY#^]$1]"!:0(^@ +M)]&YF->VP2^&^B$O(O,-F#_8GC^&OM"9M]^U;]C7[6W[9_:;]H_MJ_:/["W[ +M=?LU^X5WTA\`>>>+OJL'CS[778=&,MHEAP%;[MHL6'V$84:`D0#LMXY-P;?- +M=&T:/#[5M1FP5[HV"_;WQ@_-[+MW?^:!1TX^?#IW^/&3QQ[[;T;0.#H$Z^]# +M]P(J&?0`8'82/8Q.H\/0+J(OH4F@,X:6X!O/ +M(8*`!+\B0MSOV!_"&-YEY*\'0M]\R%W_._9T=O;KQ?V?W^WMK[4:W!<=UQ#9 +M[EW_?PDP`(#,`-4-#65N9'-TW!4U1G_G7/OS280PB(0 +M\B#DKI=$3'8%:2`)$%R2W00:'PD:NXL"N^1!>$0"9E(>`Y,1JG]^3L.=_Y +MOO.=W_?[OG-W`P$@&6U0X*UM"C/]T:2_E9RA.6KZ@-#^])/@AD7Z"W9P82'R5^P]3 +MUN\)-]4_LN/\5X!K%_$4-J^XM\6R+>%:;>N;5]4W^\Y_-I_^:.]8I+4091$R +MM!J,5)J0`5C'V$^Q?Q6;9\6T`GABSUN?*$2`WPWT_L>%Y[$-KV,UUG-^'Z*8 +M@#R4DY5G<0N"Z!%>3(+$8WB`=A>1A@HL$R=YQ@MHQ#NTRX$?.Y'*]3JTC$FSA*WV[,10WVRP[K"&[$+AP6+ZN*M96>;L!4-.%^M%LO +MPH,2>FK#KX0A[K5Z,9^MB;@>QFY\8!UA7`X,B6.<0-1`&\F(79"!#W.FS!HT3V!HZ)!;)%Z;!\UFO6 +MNW:NN#^7*(KQ<]R&56CA"3OQ9W3A.W&G3+'&6T]97=8!ZTO:2FC(0C;WE*"2 +M?N=C,=KI-\J(/\0QMAY\+I+%=#%+5(E-8I%`B?>$IFR>ME@UPA]\LO547= +MK/98I^-()#/A()-3B'PF;F:K(6^_1(2(MN(WS-T.(GL6W7B+F3F!7GR'2T(3 +M#I$H)HB)]#Z'^#X4'\L4F2H-62I/*/G*3&6%^I[:H_EC[;'S5L`*6BNM5QC] +MQSS+CMSFZ2XL(.(ZQM[*;&]@[NRVD>U!/(EG\!PK;`_^PI/_P;/?P1$G$!W^(2^H@B63C91HNQ;#G"0]9F,JM5HEJTB@VB36P4]XMV8GQ<[!.O +MB(-DLD(&Y'RY7CXH7Y7OR??E1_*4/"N_49*4+,5%CM]4*]1YZHM:BK906Z>U +M:7L2IO9=B!7&?A%;$&N-';(<5HJ59[5:ZZTGK"BS>B[.9"*&8PP,9B2?6;T9 +MM[)5L=+F8Q%JT8!ES,UJLKF3?#[&")_#B\S3RZRE@XSN/6;].#YG9-_@>_0A +M)B!4\IS.>LX3DQE1!2.Z0]2(@+A;+!`+18-H%"O%6K&.,6YF:Q-T"9J15J-5JP/F7O93\=*^5[D+K8:]9191R] +M+[6.:FW,880W_AK>B$,XI2:)6_G^6*@4L'[K^&:9%+]]\$Z^<=+$&SSN_+SK +M)UR7FS/>N-:E9X_+&IN9D9XV)G7TJ)'7C'`.3QF6/'1(4J(C05,5*>#V&^4A +MWFE9<,/++W]EMY!2^'4 +M9V"&QZW[#=T\Y#/TJ)A7'>#\(9\1U,W>^/R6^%S-C0O#*+A392%US>F<;`M_&:&X?.;Z88O +MKE-R_.$ZLZHZX/=ENEQ!C]L49;7&(A-&J3D\?V![W+/I*#,3RNA:7V('@,UZ +MI[L[LB7JQ*)0?G*=41>^.V`JX:!]Q(A\L[4G[CWAYYM\RH/R,2E/F +ME(?K(^6D9O/L?C%D2^$ME"IOU^E3;@H&3+&)CG4;K@V]/XAZPV^OA);J9I)1 +M:C1&EH;(>4;$Q-PUKKT9&=XNBU]N?CUR1\!PF3=E&L&P;VSG*$3FKOECNE=/ +MOUKC<7>E;9CN(F5=GEF>6?8XW96VH7_\Y\;^]2/=0^-V^T]RK)P[R)JP@1AS +M&(6IU^H$$#`82I']45^$2&T1S?@$!4E88B:5A2+.:3:G6H[3T"-?@VDT>L]> +MO1(>6$G(<7X->VHG>[!@J+\\-_/SS;P\YISYJ6>:"&UF?&&*Q]UJ9AK-3MW, +M)%6H(H_AX+2)Y-WELE.V.>K%(@IF6W6@7]:Q*',OO!/S@Z8,V9KNRYK1-;:F +M[;)F<'O(8#7N@_T3;+29F#OX-]R9.M+?.,T4J3^BKH_KHYCLKHPBJ2K0*41[ +M,"JL35'XLKJ0!&7A`JI_9I?[$A_CIU#@YD*>B[,I;KV3[:`>T2-SZB)Z +MN=[(@E9SXB,5]9'@1(9^>V`)/^\(N$QO,'-P6A\,3J.?J;8?->XG$J2'I0,> +MEL8]T$$?C0K=E4QR;E6@.F"V^3)-KR_(I/)^=)/6;M9!,$BKHD&D'-!>BHJTJ +MKFHS7)GV@N$R7(05]/&HZ;P_EPLTBAD_SG#)E0S/)-J2.,,W_8\8]OX4AF?] +M)(9+_SO#9<1<:C/L^_\Q[+^"8;O"$Q"S_Q'YI&]WW^[$C$3(G*N^'X>HGUJ] +MDA.5_RS(XMB[')W:`8SA.%6%5:MDH4`6XQ9F*Y]W(O]5^5N1S!_'V7+[WJKB +M[*C=] +MSGN.'Y][[CEX>F!Z"I\GYT-XFDR'\'G^?`)/\],)+.+DI9"/F$0\E6HA1A%/ +M`AA$?`Q`+^*C`+DBG@#0B7@<0"OB,0"-B(\`<"(^#*`6\2L`.2)^&2!;Q(<` +M5")^"4`IXE$`5L0'`10B/@"0)>+]`'(1CP#(1+P/`":S%P")>!B`$?%01`N( +M$&)42#JH*2.-1ER/]C#]#(=V4[^5^HW4&ZG742^_W,_]N)]KS$8?P/F?0W>H +M[Z7>$-'TMW%]:N3^U, +M^WB,^^T85S;&E8QQMC%HO7!9VZ9E5%?AS-,&"3Y,)5SD7?0^P\.O).B]%'^5 +M-.:CFTQ(+M6O9W"6(12O,%%4"O@[II/B.4902NW;4PD_$=&V5*(>X-E48@O` +MEE1B&T!W*K$#AO@^DZ!=.E/\(FG,11L8GJ9%YDF+G>9OABF@*R3.SY,F.QTX0F@@ +MG*X%TVD#Z9J7T&Q54[2Q(OU+W/`379UT[DZ89FE$2U:3`5(4W46ZB(JHDE?1 +M8;A>)=%HI)9-GF:3A]CD()O\(9OLW@2'[BL2Q +MSY3&\=Y,:2\>HB5XB2])8P*F6AE&^JC,H-=F%$?AF#&#CA?,P"'F>+?%;!X* +M6\+ZAMS:YMA_<=LSWOGTL7SG#LYO/Z@ML>\&+-,O0'J";E!_\0I+[K'D'98R +MVC8"(4D)24I(2H3D/3:9(5AL,R=A;Y\Y:^N>J98*3VS=;3,>Z3PZB\.X/AZ; +MQ0T2=&^>91[@<'R#U,X\B'4#;0NEP:X=!AH3D@!HZ"Q#)!I,YBRE]:9I/&Z0 +M:`D)@(:'&9[2>#Q,:8L2[>)`*!Z[&`I1BOP:,T`I`_)KWZ),_2=EBE*F,I0" +M2A$$H$0%B7*Q6`#"1:&8AE<_#7>FPYYTV$/#P:=A>SK;_HN +M[/@/-C:9F7#8XM35H0I6/:.`6PM;\K]R#&8>*,(+@Z5[IJ(DJX:1P0)HBJCD +M;)S)4L0Q?*/*(P:9C,E6L''$Y"NQ+)XE[U:MS*(?,3#4EW7+=>O!=RS7,>$Z +MW3)4P555EN06Y0I@!D5`?!S*JOEJ3I3-?5TC??DQ0YY\)KLGFV(X)L[&^\#[YD&.H8CAV3#[A'H^]'56KO1J?VF_U6GU6?T',T533U,GOY,\4 +MGN%GO:)/],]YYWQS?D-.43#(Z]5R%9:I@WI],$CT/&_-LU1B(YM)@ +M5:4JVI`C5=9Y6JR*4&,SWVRWZIKX`1[S?$MV2W/%72IIK +MARKJK7)P'=;<1,/*87'U>+=)9YZHJ40_3PY25 +M%+,*D]'LK0X&_&5Y9H*"#2B,JLVL!K$R1286"".I-4^#2HK+_+Y`$((0HY5@ +MP(L_;ZKX]:O[X]XW7SWD<>9Q66:Y(N=%E0S+Y?)G"TVEVAR529NK-&H:+'VC +MM:6.`D[?U;`NZJO\WI%W;WTHL\:^6CB=6/>OCU.S#O-J33NG0ARKXK2:E5,_ +MZ3IEUG!JM88U:"*FL>=\PNH)3^%@H+%`/S;RY\4E:?-<^6"E2]:;]0+C8XY' +M`KLJ4;ZNV=7E&G+)W>5ZK<%`]`Y'.<;:JE6KS/XZ[6ZMHE0P:[.\ +MOD`^?!]06\3D\-O=Y>6Z[8Y^QPF'S-'B\&<'_&F=ARIZ+,XZW6U)ZT?+NOO+ +MH'$8E)>6D:1\A622SED@]&W=S8RZ&85\`I69];(ELNR,A-YJL\GXC?)!0TG0 +M&PC21EFO2RAV&3C.M*.IU/-0\_#U-7=^WK)5$(HK3'GZKC7$^OM9S;7Z]A?/ +MM#\OGZ]QVHQ57+;J5ST+T>7AE<;]XOVQ+]K/^=]=4, +MO"FZEYA]Q'KA/MP[(3]+=?)F#+'E5.):^3-[?)8 +M]G/NC;6[72.NP9JWY">SN9BM*,F\VVD$R(A$(V +ME>\-OOJZ2O"P-F&M-C_8VJX.]3N33NQLUX9>BI^.XWA<$?*>ZP\F@SC8T5ZQ +M<+]G<;FVHF=)=Q_LHR5)TN5'UOPEBR2FESP%PATW>>9TS4_ZC7P +M&[>\%@KU'SLU[3!7.=[76D\.UFU>F1P\F,_7\FLCGIJ_7]@ZFC.Q4Z%X_%.M +MU:"U%BS\;>'!J&)J*[$YO`7 +M5EE<:[:].5?[;]:K/[:IXX[?>_=^V,_.\_GWLU_LYY_Q"[9Q8B>.XCB)'6=. +M[,3&)"D55"GI:/C1P1)^166L%-8"!:V_8&PMJ!*L6Z?1_;%UW=32K:(B+&S+ +M5&D%)D&G;@.DP11-FP32IA'OWK-#T;2VT[9[]MWW3E^?=9_[W.=SSURQ!;S? +M/`,IE\ON&QD]^?B/GEX+U`N`O7J+/H7W9H1HS9SI6E%,%[M7K-@9W9D^&&7I +M'C;7W!A:F43MP^VEY,KSQ=\4;Q1UY?**WE(I6YS.;90+_N+0<*Z-;@HB`Z-) +M64I<1"X['4:&3O652UF&;C,B1\;A=1:<:,R`D&0*!IO:$@G)%(_3N;X^R93- +MEB(=7*IC9&288_NR"3G.67)N77!4;D)[@P0*]@?'@D>";P3I8'"4H]%8_-'X +M5^*OQW\4$(Q\)+HJ2T6U5U4C8VG$XKBIM&"VCA(+T\S.-S +M@ENA%O`XJ"N4JF%.A0*UCRI8836V=PH`W5X(_X.X?1#Q3\QJTO=X@'>1K9\? +M"Y8MA1=8QSKLK*)8ZO9WF'N(&E449?-_W%.>>I=M3W;8H3(/]$DMWO!4Y<6I +M6-E\E.+-)M%J<71)W."1`8_-1],O0.@PY][H2[=F3[Q+0JO0^W97JMW3?OP< +MI)*ER3]H=DZM>V8C/&3S#OMV'3B]^E1FP/;`W8\:1)/5XAX4^/6[D+/;X+.2 +M+7JD$9R_V/C8\W\EY[1&K2#^^J'57UOS77).9]&%$/2A.+NX[EM?/%+SHF3U +M%OPI]B(>-(*)S&">&M07&E9;5HDSU.Z&KS:\K/^EZ;SCBNF2XX;AINVFXX[A +M[S:35J?5DZP>+T`\1%%(`07DS(6W:[8AS.7!7P(Q]53N*#B +MNG4\6;.%NGQ9@0+N/=&_-EIY=<\73/[QEP_L(2N'WWGOZN'7SKS[VZ>WW/G@ +M!T/+'[QQ^7WRS1]^Z>+\Q9,O7KWP*\6SURVN@6?A81`!W:":F4ZY\UV?2\^V +M4FQCT)@P)EWM[@+8U?4S_A)_C;]AOA/1FRT6F\^?2`8"Q@@$_D@F/!%8Y@_S +MT]25Q8 +MN(ZIBW&YOG"?E=;)B15)I:=*UH\)"M""XK).M3VKTA47S2Q?YRR,W\_(4#!I +M9PS$/0:K`L76W-=N]8)0C:GDDE&_DN[F%SFZ-<:9.)+H82`DD_V=&Z:V[IL[ +M?W%9:ADO<,ZV$H;[VTAZH/"]N)SOC7S_P..+NZ-)^'[`H_5Z"-(7(S0\>VY- +M;-7^0W^Z]`$R=VV(;#!?Y$!K`/\;&L+&,>XVJP,"_')K[DK1C%&J(YP_RE7NNU*#G&:)8A';8/O +M/1A+)**21ZNG=)K0T90_+$:/O\8;W4%]P"&7WZ;A?"#][LT>.=@G( +MQK!7GBP]63E*KFD;<;H]%/1J4$#!J52]13Y,/0Q"X#N9AV@7[::E5=)Z:4;: +M+QV3-(S03]^T_LU*922OQU,0!!**)*0@9\[07@CM)#3;!;M=,D%!,I$DM!_C +M+8R2FQ=S`1TIRQ"1>5+FFN6E:XFPI+`S'SJ[E?O>_%U"(2D*(YI-DQJ4!IB& +MA!/-HPL:4J$H1OE"S-G]^S`H-KN;,!#*386I74UJ&MK4 +M7B+A3U[2H,FI"02U-$=!@NA\57_Z31J9G3$QX^17/=656%ZTZLAW1)X-5[:9 +M*9HD61US)7=WKB&5"E)J3`.&!1J@_5_G_'\6"E1PC?`#<>L!CX`- +M8`N8!MO`CFJU/K(>CTS51JJ_KYZJOE)]J?J-ZM>KQ_XM/'B>ZE\^]3\U>$:B +MGFL&2R!3.#;78P9'3DQB?UI9CR'.6%N/*1SOK\<,CE_/5LH# +M_?GPV*8MD]NCA1V/;-ZT[C\;`ED,2!D,@'Z0!V$P!C;AQ4^"[6`$UQO`3K`9 +M`[+M$[.BH`!VX(S->.23Y_IOLE1D.'`0K_(L1I!4]RP/`/M']O-X_<327EQZ +M5KZVUI"^31@U:O]%LQ,C0@,"`V,C4@-C(U72]!7!E+T9O;G0^/@UE;F1O8FH-,30@,"!O +M8FH\/"]3=6)T>7!E+U1R=654>7!E+T9O;G1$97-C7!E+T9O;G0^/@UE;F1O8FH-,34@,"!O8FH\/"].=6US +M6S`@,38@,"!273X^#65N9&]B:@TQ-B`P(&]B:CP\+U,O1#X^#65N9&]B:@TQ +M-R`P(&]B:CP\+T-O=6YT(#(O5'EP92]086=E7!E+UA-3"],96YG=&@@,S4U +M,R]4>7!E+TUE=&%D871A/CYS=')E86T-"CP_>'!A8VME="!B96=I;CTB[[N_ +M(B!I9#TB5S5-,$UP0V5H:4AZDY48WIK8SED(C\^"CQX.GAM<&UE=&$@ +M>&UL;G,Z>#TB861O8F4Z;G,Z;65T82\B('@Z>&UP=&L](C,N,2TW,#$B/@H@ +M("`\"UN&UL;G,Z9&,](FAT='`Z+R]P=7)L+F]R9R]D8R]E;&5M96YT"UD969A=6QT(CY- +M:6-R;W-O9G0@5V]R9"`M($5-0D]34U]Q9RYD;V,\+W)D9CIL:3X*("`@("`@ +M("`@("`@/"]R9&8Z06QT/@H@("`@("`@("`\+V1C.G1I=&QE/@H@("`@("`\ +M+W)D9CI$97-C&UL;G,Z>&%P34T](FAT='`Z+R]N&%P+S$N,"]M;2\B/@H@("`@("`@("`\>&%P34TZ1&]C=6UE +M;G1)1#YU=6ED.C9C,S9C93,W+3&%P34TZ1&]C=6UE;G1)1#X*("`@("`@("`@/'AA<$U-.DEN#IX;7!M971A/@H@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@"B`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`*("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@(`H@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@"B`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`*("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M(`H@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@"B`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`*("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@(`H@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M"B`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`*("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@(`H@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@"B`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`* +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@(`H@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@"B`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`*("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@(`H@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@"B`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@("`@("`@("`@("`@("`@("`*("`@("`@("`@("`@("`@("`@("`@("`@ +M("`@"CP_>'!A8VME="!E;F0](G')E9@TP(#(P#3`P,#`P,#`P,#`@-C4U,S4@9@T*,#`P,#`V,S`U +M.2`P,#`P,"!N#0HP,#`P,#8S,3DS(#`P,#`P(&X-"C`P,#`P-C,S,S@@,#`P +M,#`@;@T*,#`P,#`W-C`W-R`P,#`P,"!N#0HP,#`P,#DQ-S4P(#`P,#`P(&X- +M"C`P,#`P.3$Y-3@@,#`P,#`@;@T*,#`P,#$P.30R-2`P,#`P,"!N#0HP,#`P +M,3`Y-C(X(#`P,#`P(&X-"C`P,#`Q,34X.#4@,#`P,#`@;@T*,#`P,#$Q-C`Y +M,2`P,#`P,"!N#0HP,#`P,3$V,C0Y(#`P,#`P(&X-"C`P,#`Q,38U.3,@,#`P +M,#`@;@T*,#`P,#$Q-S$P-B`P,#`P,"!N#0HP,#`P,3$W,C8T(#`P,#`P(&X- +M"C`P,#`Q,3F4@,C`^/@US=&%R='AR968-,3$V +'#24E14]�`` +` +end --- emboss-6.1.0.orig/debian/control +++ emboss-6.1.0/debian/control @@ -0,0 +1,124 @@ +Source: emboss +Section: science +Priority: optional +Maintainer: Debian Med Packaging Team +DM-Upload-Allowed: yes +Uploaders: Charles Plessy , Nelson A. de Oliveira +Build-Depends: debhelper (>= 7), quilt, libx11-dev, x11proto-core-dev, libgdchart-gd2-xpm-dev, zlib1g-dev, libpng12-dev, libpcre3-dev, antiword, sharutils, autotools-dev, tcsh | csh | c-shell +Build-Depends-Indep: openjdk-6-jdk +Vcs-Browser: http://git.debian.org/?p=debian-med/emboss.git +Vcs-Git: git://git.debian.org/git/debian-med/emboss.git +Standards-Version: 3.8.3 +Homepage: http://emboss.sourceforge.net + +Package: emboss +Architecture: any +Depends: ${shlibs:Depends}, ${misc:Depends}, emboss-data (= ${source:Version}), csh | c-shell +Recommends: primer3, dialign +Suggests: emboss-doc, emboss-test, embassy, clustalw +Description: the european molecular biology open software suite + EMBOSS is a free Open Source software analysis package specially developed for + the needs of the molecular biology (e.g. EMBnet) user community. The software + automatically copes with data in a variety of formats and even allows + transparent retrieval of sequence data from the web. Also, as extensive + libraries are provided with the package, it is a platform to allow other + scientists to develop and release software in true open source spirit. EMBOSS + also integrates a range of currently available packages and tools for sequence + analysis into a seamless whole. EMBOSS breaks the historical trend towards + commercial software packages. + +Package: emboss-data +Architecture: all +Depends: ${misc:Depends} +Description: data files for the EMBOSS package + This package includes data files needed by EMBOSS, the European Molecular + Biology Open Software Suite. + +Package: emboss-doc +Section: doc +Architecture: all +Depends: ${misc:Depends} +Suggests: pdf-viewer | postscript-viewer +Description: documentation for EMBOSS + This package includes non-essential user documentation for EMBOSS, the + European Molecular Biology Open Software Suite. + +Package: emboss-test +Section: misc +Architecture: all +Depends: ${misc:Depends} +Recommends: tcsh | csh | c-shell +Suggests: valgrind +Description: test files for the EMBOSS package + This package includes test files for EMBOSS, the European Molecular Biology + Open Software Suite. + . + It is a good idea to use the data from this package for your bug reports when + possible. + +Package: emboss-lib +Section: libs +Architecture: any +Depends: ${shlibs:Depends}, ${misc:Depends} +Description: EMBOSS Libraries + This package is being emptied. For the moment it contains a eplplot, an EMBOSS + fork of the plplot library. + +Package: jemboss +Architecture: all +Depends: ${shlibs:Depends}, ${misc:Depends}, openjdk-6-jre, tcsh | csh | c-shell +Description: graphical user interface to EMBOSS + Jemboss is a Graphical User Interface (GUI) to EMBOSS, the European Molecular + Biology Open Software Suite. It is part of the EMBOSS distribution. + +Package: libajax6 +Section: libs +Architecture: any +Depends: ${shlibs:Depends}, ${misc:Depends} +Description: EMBOSS library for commands + This package contains a core library of the European Molecular Biology Open + Software Suite, EMBOSS. + . + AJAX covers standard data structures, including strings, sequences, file + handles, queues, hashes, heaps, lists, dictionaries, trees and dynamic + arrays. It also covers standard algorithms including comparisons, pattern + matching, sorting, and iterators. AJAX will also provide a set of high level + graphics functions suited to the needs of sequence analysis applications. + . + This package contains the runtime library files needed to run software + using libajax. + +Package: libajax6-dev +Section: libdevel +Architecture: any +Depends: ${shlibs:Depends}, ${misc:Depends}, libajax6 (= ${binary:Version}) +Conflicts: libajax5-dev +Replaces: libajax5-dev +Description: development files for libajax + This package contains the header and development files needed to build + programs and packages using libajax. + +Package: libnucleus6 +Section: libs +Architecture: any +Depends: ${shlibs:Depends}, ${misc:Depends} +Description: EMBOSS library for molecular sequence analysis + This package contains a core library of the European Molecular Biology Open + Software Suite, EMBOSS. + . + The NUCLEUS library provides higher-level functions specific to molecular + sequence analysis, including sequence comparisons, translation, codon usage + and annotation. + . + This package contains the runtime library files needed to run software + using libnucleus. + +Package: libnucleus6-dev +Section: libdevel +Architecture: any +Depends: ${shlibs:Depends}, ${misc:Depends}, libnucleus6 (= ${binary:Version}) +Conflicts: libnucleus5-dev +Replaces: libnucleus5-dev +Description: development files for libnucleus + This package contains the header and development files needed to build + programs and packages using libnucleus. --- emboss-6.1.0.orig/debian/emboss-doc.dirs +++ emboss-6.1.0/debian/emboss-doc.dirs @@ -0,0 +1 @@ +usr/share/EMBOSS/doc --- emboss-6.1.0.orig/debian/emboss-java.dirs +++ emboss-6.1.0/debian/emboss-java.dirs @@ -0,0 +1 @@ +usr/bin usr/share/EMBOSS/jemboss/org/ --- emboss-6.1.0.orig/debian/build-manpages.sh +++ emboss-6.1.0/debian/build-manpages.sh @@ -0,0 +1,20 @@ +#!/bin/sh +# Copyleft 2007 Charles Plessy, do what you want with this trivial file. + +set -v +set -e + +PACKAGE=$(dpkg-parsechangelog -ldebian/changelog | grep Source: | cut -f2 -d' ') +VERSION=$(dpkg-parsechangelog -ldebian/changelog | grep Version: | cut -f2 -d' ' | cut -f1 -d-) +ORIGTARGZ=../${PACKAGE}_${VERSION}.orig.tar.gz + +rm -f debian/$PACKAGE.manpages + +for FILE in $(tar --list --gzip --file $ORIGTARGZ | grep \\.acd | grep -v /test/) + do + ACD=$(basename $FILE .acd) + tar --verbose --gzip --file $ORIGTARGZ --extract $FILE --to-stdout \ + | ./debian/acd2docbook.pl /dev/stdin ${VERSION} \ + | xsltproc --nonet --param man.charmap.use.subset 0 -o debian/manpages/ - + echo "debian/manpages/$ACD.1e" >> debian/$PACKAGE.manpages +done --- emboss-6.1.0.orig/debian/emboss-doc.doc-base.domainatrix +++ emboss-6.1.0/debian/emboss-doc.doc-base.domainatrix @@ -0,0 +1,13 @@ +Document: domainatrix +Title: Domainatrix guide. +Abstract: This document describes the use of EMBOSS applications in the EMBASSY + package domainatrix. Most of these directly or indirectly make use of the + protein structure databases pdb and scop. All of the applications here + were written by Jon Ison, Ranjeeva Ranasinghe, Matt Blades and Waqas Awan + and coordinated by Jon Ison to whom enquiries should be sent (email + jison@hgmp.mrc.ac.uk). This software is part of an experimental analysis + pipeline and we provide it in the hope that it will be useful. +Section: Science/Biology + +Format: Text +Files: /usr/share/doc/emboss-doc/doc/manuals/domainatrix.txt --- emboss-6.1.0.orig/debian/reference +++ emboss-6.1.0/debian/reference @@ -0,0 +1,16 @@ +@article{Rice2000276, +title = "EMBOSS: The European Molecular Biology Open Software Suite", +journal = "Trends in Genetics", +volume = "16", +number = "6", +pages = "276 - 277", +year = "2000", +note = "", +issn = "0168-9525", +doi = "DOI: 10.1016/S0168-9525(00)02024-2", +url = "http://www.sciencedirect.com/science/article/B6TCY-40CRS27-G/2/b4e5945c07c58d5a1257cbd685971317", +author = "Peter Rice and Ian Longden and Alan Bleasby", +keywords = "Bioinformatics", +keywords = "Database", +keywords = "EMBOSS" +} --- emboss-6.1.0.orig/debian/emboss-doc.links +++ emboss-6.1.0/debian/emboss-doc.links @@ -0,0 +1 @@ +usr/share/EMBOSS/doc usr/share/doc/emboss-doc/doc --- emboss-6.1.0.orig/debian/emboss.dirs +++ emboss-6.1.0/debian/emboss.dirs @@ -0,0 +1,4 @@ +usr/bin +#usr/share/applications +etc/emboss/embossrc.d +usr/share/man/man1 --- emboss-6.1.0.orig/debian/emboss-doc.doc-base.emboss-groups +++ emboss-6.1.0/debian/emboss-doc.doc-base.emboss-groups @@ -0,0 +1,9 @@ +Document: emboss-groups +Title: EMBOSS Application Groups +Author: The EMBOSS Developpers +Section: Science/Biology +Abstract: Documentation of the EMBOSS applications organized into logical groups according to their function. + +Format: HTML +Index: /usr/share/doc/emboss-doc/doc/programs/html/groups.html +Files: /usr/share/doc/emboss-doc/doc/programs/html/*.html --- emboss-6.1.0.orig/debian/emboss-lib.postinst +++ emboss-6.1.0/debian/emboss-lib.postinst @@ -0,0 +1,10 @@ +#!/bin/sh +set -e + +case "$1" in + configure) if [ -x /sbin/ldconfig ]; then /sbin/ldconfig ; fi ;; + abort-*) exit 1 ;; + *) ;; +esac + +#DEBHELPER# --- emboss-6.1.0.orig/debian/emboss-doc.doc-base.emboss-qg +++ emboss-6.1.0/debian/emboss-doc.doc-base.emboss-qg @@ -0,0 +1,11 @@ +Document: emboss-qg +Title: EMBOSS, a quick guide. +Author: David Martin, EMBnet Norway +Abstract: Summary of emboss programs and their options on a recto-verso page. +Section: Science/Biology + +Format: PostScript +Files: /usr/share/doc/emboss-doc/doc/manuals/emboss_qg.ps + +Format: PDF +Files: /usr/share/doc/emboss-doc/doc/manuals/emboss_qg.pdf --- emboss-6.1.0.orig/debian/libajax6-dev.dirs +++ emboss-6.1.0/debian/libajax6-dev.dirs @@ -0,0 +1,2 @@ +usr/lib +usr/include --- emboss-6.1.0.orig/debian/emboss-data.install +++ emboss-6.1.0/debian/emboss-data.install @@ -0,0 +1 @@ +debian/emboss_tmp/usr/share/EMBOSS usr/share --- emboss-6.1.0.orig/debian/acd2docbook.pl +++ emboss-6.1.0/debian/acd2docbook.pl @@ -0,0 +1,167 @@ +#!/usr/bin/perl -w + +# acd2docbook.pl was made for Debian by Charles Plessy in 2007, and can be +# used, modified and redistributed as if it were in the public domain. +# +# You can report bugs to bugs.debian.org/emboss, and access the latest version here: +# http://svn.debian.org/wsvn/pkg-emboss/emboss/trunk/debian/acd2docbook.pl?op=file&rev=0&sc=0 +# +# Many thanks to David Bauer for the original idea. + +use strict; +use warnings; + +use EMBOSS::ACD; + +my $acdfile = shift; +my $embossversion = shift; +my $date = qx(date -R); +chop $date; + +my $acd = EMBOSS::ACD->new($acdfile) ; + +my $name = $acd->name or die "No name !"; +my $NAME = $name; +$NAME =~ s/(.)/\U$1/g; +my $purpose = $acd->documentation; +my $groups = join(",", $acd->groups); + +print <<"__XML__"; + + + + + + + + + + + + + +]> + + + + &dhtitle; + &dhproduct; + &dhrelease; + + + &dhusername; + Wrote the script used to autogenerate this manual page. +

+ &dhemail; +
+ + + + This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself. + + + + + &dhucpackage; + &dhsection; + + + + &dhpackage; + $purpose + + + + + &dhpackage; +__XML__ + +foreach my $parameter ( $acd->param) { + next if $$parameter{datatype} =~ /section/; + my ($paraname, $argname, $paratype) = ( $$parameter{name}, $$parameter{datatype}, $$parameter{type} ); + my $additional = 'choice="plain"'; + $additional = 'choice="opt"' if $$parameter{additional} eq 'Y'; + print qq(\t\t\t\n); +} + + +print <<"__XML__"; + + + &dhpackage; + + + + + DESCRIPTION + &dhpackage; is a command line program from EMBOSS (the European Molecular Biology Open Software Suite). It is part of the "$groups" command group(s). + + + + + + OPTIONS +__XML__ + +foreach my $parameter( $acd->param) { + + # Does a section begin ? + if ($$parameter{datatype} eq "section") { + print qq(\t\t\n\t\t\t$$parameter{information}\n\t\t\t\n); + next; + } + + # Does a section end ? + if ($$parameter{datatype} eq "endsection") { + print "\t\t\t\n\t\t\n"; + next; + } + + # Is there a Default value ? + my $default = ''; + $default = " Default value: $$parameter{default}" if $$parameter{default}; + + # Use entities when necessary: + $$parameter{help} =~ s/&/&/g ; + $$parameter{help} =~ s//>/g ; + $default =~ s/&/&/g ; + $default =~ s//>/g ; + + + + print<<"__XML__"; + + + + $$parameter{datatype} + + + $$parameter{help}$default + + +__XML__ +} + +print<<"__XML__"; + + + + + BUGS + Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031). + + + + SEE ALSO + &dhpackage; is fully documented via the tfm1 system. + + +__XML__ --- emboss-6.1.0.orig/debian/emboss.menu +++ emboss-6.1.0/debian/emboss.menu @@ -0,0 +1,636 @@ +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="aaindexextract" \ + description="Extract data from AAINDEX" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/aaindexextract;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="abiview" \ + description="Reads ABI file and display the trace" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/abiview;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="antigenic" \ + description="Finds antigenic sites in proteins" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/antigenic;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="backtranambig" \ + description="Back translate a protein sequence to ambiguous codons" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/backtranambig;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="backtranseq" \ + description="Back translate a protein sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/backtranseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="banana" \ + description="Bending and curvature plot in B-DNA" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/banana;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="biosed" \ + description="Replace or delete sequence sections" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/biosed;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="btwisted" \ + description="Calculates the twisting in a B-DNA sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/btwisted;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="cai" \ + description="CAI codon adaptation index" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cai;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="chaos" \ + description="Create a chaos game representation plot for a sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/chaos;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="charge" \ + description="Protein charge plot" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/charge;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="checktrans" \ + description="Reports STOP codons and ORF statistics of a protein" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/checktrans;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="chips" \ + description="Codon usage statistics" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/chips;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="cirdna" \ + description="Draws circular maps of DNA constructs" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cirdna;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="codcmp" \ + description="Codon usage table comparison" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/codcmp;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="codcopy" \ + description="Reads and writes a codon usage table" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/codcopy;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="coderet" \ + description="Extract CDS, mRNA and translations from feature tables" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/coderet;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="compseq" \ + description="Count composition of dimer/trimer/etc words in a sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/compseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="cons" \ + description="Creates a consensus from multiple alignments" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cons;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="cpgplot" \ + description="Plot CpG rich areas" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cpgplot;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="cpgreport" \ + description="Reports all CpG rich regions" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cpgreport;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="cusp" \ + description="Create a codon usage table" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cusp;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="cutgextract" \ + description="Extract data from CUTG" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cutgextract;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="cutseq" \ + description="Removes a specified section from a sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cutseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="dan" \ + description="Calculates DNA RNA/DNA melting temperature" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dan;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="dbiblast" \ + description="Index a BLAST database" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbiblast;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="dbifasta" \ + description="Database indexing for fasta file databases" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbifasta;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="dbiflat" \ + description="Index a flat file database" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbiflat;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="dbigcg" \ + description="Index a GCG formatted database" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbigcg;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="dbxfasta" \ + description="Database b+tree indexing for fasta file databases" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbxfasta;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="dbxflat" \ + description="Database b+tree indexing for flat file databases" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbxflat;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="dbxgcg" \ + description="Database b+tree indexing for GCG formatted databases" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbxgcg;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="degapseq" \ + description="Removes gap characters from sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/degapseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="descseq" \ + description="Alter the name or description of a sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/descseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="diffseq" \ + description="Find differences between nearly identical sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/diffseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="digest" \ + description="Protein proteolytic enzyme or reagent cleavage digest" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/digest;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="distmat" \ + description="Creates a distance matrix from multiple alignments" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/distmat;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="dotmatcher" \ + description="Displays a thresholded dotplot of two sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dotmatcher;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="dotpath" \ + description="Non-overlapping wordmatch dotplot of two sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dotpath;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="dottup" \ + description="Displays a wordmatch dotplot of two sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dottup;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="dreg" \ + description="Regular expression search of a nucleotide sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dreg;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="einverted" \ + description="Finds DNA inverted repeats" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/einverted;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="emma" \ + description="Multiple alignment program - interface to ClustalW program" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/emma;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="emowse" \ + description="Protein identification by mass spectrometry" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/emowse;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="entret" \ + description="Reads and writes (returns) flatfile entries" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/entret;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="epestfind" \ + description="Finds PEST motifs as potential proteolytic cleavage sites" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/epestfind;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="eprimer3" \ + description="Picks PCR primers and hybridization oligos" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/eprimer3;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="equicktandem" \ + description="Finds tandem repeats" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/equicktandem;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="est2genome" \ + description="Align EST and genomic DNA sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/est2genome;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="etandem" \ + description="Looks for tandem repeats in a nucleotide sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/etandem;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="extractfeat" \ + description="Extract features from a sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/extractfeat;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="extractseq" \ + description="Extract regions from a sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/extractseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="findkm" \ + description="Find Km and Vmax for an enzyme reaction" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/findkm;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="freak" \ + description="Residue/base frequency table or plot" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/freak;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="fuzznuc" \ + description="Nucleic acid pattern search" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/fuzznuc;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="fuzzpro" \ + description="Protein pattern search" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/fuzzpro;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="fuzztran" \ + description="Protein pattern search after translation" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/fuzztran;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="garnier" \ + description="Predicts protein secondary structure" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/garnier;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="geecee" \ + description="Calculates fractional GC content of nucleic acid sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/geecee;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="getorf" \ + description="Finds and extracts open reading frames (ORFs)" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/getorf;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="helixturnhelix" \ + description="Report nucleic acid binding motifs" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/helixturnhelix;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="hmoment" \ + description="Hydrophobic moment calculation" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/hmoment;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="iep" \ + description="Calculates the isoelectric point of a protein" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/iep;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="infoalign" \ + description="Information on a multiple sequence alignment" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/infoalign;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="infoseq" \ + description="Displays some simple information about sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/infoseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="isochore" \ + description="Plots isochores in large DNA sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/isochore;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="lindna" \ + description="Draws linear maps of DNA constructs" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/lindna;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="listor" \ + description="Write a list file of the logical OR of two sets of sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/listor;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="makenucseq" \ + description="Creates random nucleotide sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/makenucseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="makeprotseq" \ + description="Creates random protein sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/makeprotseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="marscan" \ + description="Finds MAR/SAR sites in nucleic sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/marscan;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="maskfeat" \ + description="Mask off features of a sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/maskfeat;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="maskseq" \ + description="Mask off regions of a sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/maskseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="matcher" \ + description="Finds the best local alignments between two sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/matcher;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="megamerger" \ + description="Merge two large overlapping nucleic acid sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/megamerger;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="merger" \ + description="Merge two overlapping sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/merger;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="msbar" \ + description="Mutate sequence beyond all recognition" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/msbar;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="mwcontam" \ + description="Shows molwts that match across a set of files" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/mwcontam;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="mwfilter" \ + description="Filter noisy molwts from mass spec output" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/mwfilter;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="needle" \ + description="Needleman-Wunsch global alignment" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/needle;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="newcpgreport" \ + description="Report CpG rich areas" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/newcpgreport;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="newcpgseek" \ + description="Reports CpG rich regions" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/newcpgseek;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="newseq" \ + description="Type in a short new sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/newseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="noreturn" \ + description="Removes carriage return from ASCII files" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/noreturn;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="notseq" \ + description="Exclude a set of sequences and write out the remaining ones" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/notseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="nthseq" \ + description="Writes one sequence from a multiple set of sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/nthseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="octanol" \ + description="Displays protein hydropathy" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/octanol;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="oddcomp" \ + description="Find protein sequence regions with a biased composition" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/oddcomp;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="palindrome" \ + description="Looks for inverted repeats in a nucleotide sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/palindrome;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="pasteseq" \ + description="Insert one sequence into another" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pasteseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="patmatdb" \ + description="Search a protein sequence with a motif" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/patmatdb;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="patmatmotifs" \ + description="Search a PROSITE motif database with a protein sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/patmatmotifs;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="pepcoil" \ + description="Predicts coiled coil regions" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepcoil;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="pepinfo" \ + description="Plots simple amino acid properties in parallel" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepinfo;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="pepnet" \ + description="Displays proteins as a helical net" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepnet;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="pepstats" \ + description="Protein statistics" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepstats;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="pepwheel" \ + description="Shows protein sequences as helices" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepwheel;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="pepwindow" \ + description="Displays protein hydropathy" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepwindow;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="pepwindowall" \ + description="Displays protein hydropathy of a set of sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepwindowall;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="plotcon" \ + description="Plot quality of conservation of a sequence alignment" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/plotcon;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="plotorf" \ + description="Plot potential open reading frames" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/plotorf;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="polydot" \ + description="Displays all-against-all dotplots of a set of sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/polydot;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="preg" \ + description="Regular expression search of a protein sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/preg;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="prettyplot" \ + description="Displays aligned sequences, with colouring and boxing" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/prettyplot;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="prettyseq" \ + description="Output sequence with translated ranges" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/prettyseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="primersearch" \ + description="Searches DNA sequences for matches with primer pairs" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/primersearch;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="printsextract" \ + description="Extract data from PRINTS" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/printsextract;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="profit" \ + description="Scan a sequence or database with a matrix or profile" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/profit;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="prophecy" \ + description="Creates matrices/profiles from multiple alignments" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/prophecy;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="prophet" \ + description="Gapped alignment for profiles" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/prophet;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="prosextract" \ + description="Build the PROSITE motif database for use by patmatmotifs" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/prosextract;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="pscan" \ + description="Scans proteins using PRINTS" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pscan;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="psiphi" \ + description="Phi and psi torsion angles from protein coordinates" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/psiphi;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="rebaseextract" \ + description="Extract data from REBASE" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/rebaseextract;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="recoder" \ + description="Remove restriction sites but maintain same translation" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/recoder;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="redata" \ + description="Search REBASE for enzyme name, references, suppliers etc." \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/redata;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="remap" \ + description="Display sequence with restriction sites, translation etc." \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/remap;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="restover" \ + description="Find restriction enzymes producing specific overhang" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/restover;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="restrict" \ + description="Finds restriction enzyme cleavage sites" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/restrict;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="revseq" \ + description="Reverse and complement a sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/revseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="seealso" \ + description="Finds programs sharing group names" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/seealso;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="seqmatchall" \ + description="All-against-all comparison of a set of sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/seqmatchall;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="seqret" \ + description="Reads and writes (returns) sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/seqret;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="seqretsplit" \ + description="Reads and writes (returns) sequences in individual files" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/seqretsplit;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="showalign" \ + description="Displays a multiple sequence alignment" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/showalign;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="showfeat" \ + description="Show features of a sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/showfeat;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="showorf" \ + description="Pretty output of DNA translations" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/showorf;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="showseq" \ + description="Display a sequence with features, translation etc." \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/showseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="shuffleseq" \ + description="Shuffles a set of sequences maintaining composition" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/shuffleseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="sigcleave" \ + description="Reports protein signal cleavage sites" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/sigcleave;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="silent" \ + description="Silent mutation restriction enzyme scan" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/silent;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="sirna" \ + description="Finds siRNA duplexes in mRNA" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/sirna;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="sixpack" \ + description="Display a DNA sequence with 6-frame translation and ORFs" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/sixpack;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="skipseq" \ + description="Reads and writes (returns) sequences, skipping first few" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/skipseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="splitter" \ + description="Split a sequence into (overlapping) smaller sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/splitter;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="stretcher" \ + description="Finds the best global alignment between two sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/stretcher;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="stssearch" \ + description="Search a DNA database for matches with a set of STS primers" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/stssearch;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="supermatcher" \ + description="Match large sequences against one or more other sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/supermatcher;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="syco" \ + description="Synonymous codon usage Gribskov statistic plot" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/syco;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="tcode" \ + description="Fickett TESTCODE statistic to identify protein-coding DNA" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/tcode;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="textsearch" \ + description="Search sequence documentation. Slow, use SRS and Entrez!" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/textsearch;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="tfextract" \ + description="Extract data from TRANSFAC" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/tfextract;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="tfm" \ + description="Displays a program's help documentation manual" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/tfm;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="tfscan" \ + description="Scans DNA sequences for transcription factors" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/tfscan;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="tmap" \ + description="Displays membrane spanning regions" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/tmap;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="tranalign" \ + description="Align nucleic coding regions given the aligned proteins" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/tranalign;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="transeq" \ + description="Translate nucleic acid sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/transeq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="trimest" \ + description="Trim poly-A tails off EST sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/trimest;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="trimseq" \ + description="Trim ambiguous bits off the ends of sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/trimseq;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="twofeat" \ + description="Finds neighbouring pairs of features in sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/twofeat;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="union" \ + description="Reads sequence fragments and builds one sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/union;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="vectorstrip" \ + description="Strips out DNA between a pair of vector sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/vectorstrip;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="water" \ + description="Smith-Waterman local alignment" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/water;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="whichdb" \ + description="Search all databases for an entry" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/whichdb;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="wobble" \ + description="Wobble base plot" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/wobble;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="wordcount" \ + description="Counts words of a specified size in a DNA sequence" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/wordcount;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="wordmatch" \ + description="Finds all exact matches of a given size between 2 sequences" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/wordmatch;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="wossname" \ + description="Finds programs by keywords in their one-line documentation" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/wossname;echo press any key to continue; read\"" +?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \ + title="yank" \ + description="Reads a sequence range, appends the full USA to a list file" \ + command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/yank;echo press any key to continue; read\"" --- emboss-6.1.0.orig/debian/emboss.mime +++ emboss-6.1.0/debian/emboss.mime @@ -0,0 +1,6 @@ +application/vnd.appliedbiosystems.abif; abiview -auto '%s' ; description=ABIF Applied Biosystems Inc. chromatogram; nametemplate=%s.ab1 +application/x-dna; abiview -auto '%s' ; description=ABIF Applied Biosystems Inc. chromatogram; nametemplate=%s.ab1 +application/abi1; abiview -auto '%s' ; description=ABIF Applied Biosystems Inc. chromatogram; nametemplate=%s.ab1 +application/vnd.appliedbiosystems.abif; seqret -filter '%s' ; description=ABIF Applied Biosystems Inc. chromatogram; nametemplate=%s.ab1 ; copiousoutput +application/x-dna; seqret -filter '%s' ; description=ABIF Applied Biosystems Inc. chromatogram; nametemplate=%s.ab1 ; copiousoutput +application/abi1; seqret -filter '%s' ; description=ABIF Applied Biosystems Inc. chromatogram; nametemplate=%s.ab1 ; copiousoutput --- emboss-6.1.0.orig/debian/emboss.docs +++ emboss-6.1.0/debian/emboss.docs @@ -0,0 +1,7 @@ +AUTHORS +FAQ +NEWS +KNOWN_BUGS +PROBLEMS +THANKS +debian/reference --- emboss-6.1.0.orig/debian/emboss.install +++ emboss-6.1.0/debian/emboss.install @@ -0,0 +1,2 @@ +debian/emboss_tmp/usr/lib usr +#debian/abiview.desktop usr/share/applications --- emboss-6.1.0.orig/debian/TODO +++ emboss-6.1.0/debian/TODO @@ -0,0 +1 @@ +- Use libpcre from Debian (needs #387557). --- emboss-6.1.0.orig/debian/README.source +++ emboss-6.1.0/debian/README.source @@ -0,0 +1,2 @@ +This packages uses a patch system. Please read +/usr/share/doc/quilt/README.source for more informations. --- emboss-6.1.0.orig/debian/emboss-data.dirs +++ emboss-6.1.0/debian/emboss-data.dirs @@ -0,0 +1 @@ +usr/share/EMBOSS --- emboss-6.1.0.orig/debian/copyright.introduction +++ emboss-6.1.0/debian/copyright.introduction @@ -0,0 +1,119 @@ +The EMBOSS package for Debian was initially prepared by Matt Hope +(dopey@debian.org) in 2002-2004 and released on +(http://debian.bioinformatics.unsw.edu.au/). The package distributed in Debian +was prepared by the "pkg-emboss" project in 2006, using the work of Matt Hope +as a starting point. The packaging work of the pkg-emboss project is in the +public domain unless stated otherwise. + +------------------------------------------------------------------------ +EMBOSS License (http://emboss.sourceforge.net/licence/) + +The AJAX and NUCLEUS libraries are released under the GNU Library General +Public Licence. + +The EMBOSS Administrator’s Guide can be copied, distributed and/or modified +under the terms of the GNU Free Documentation License, Version 1.1 or any +later version published by the Free Software Foundation; with no Invariant +Sections, with no Front-Cover Texts, and with no Back-Cover Texts. A copy of +the license is included in the chapter entitled ”GNU Free Documentation +License”. + +The EMBOSS Quick Guide has been relicenced and can be used, modified and +distributed under the same terms as EMBOSS itself. + +EMBOSS applications are released under the GNU General Public Licence. + +Parsing of ACD files does not constitute a "derived work" and developers are +encouraged to do this, for example to write their own GUIs. + +For developers who have their own licensing conditions already in effect, there +will be an additional way to contribute. The EMBASSY collection can include +packages that use the EMBOSS core libraries and interfaces but under their own +licensing conditions. They will be bound by the Library GPL of the AJAX and +NUCLEUS libraries, but not necessarily by the full GPL. +------------------------------------------------------------------------ + +On Debian systems, the complete text of the GNU General Public License version +2, the GNU Free Documentation License version 1.2, and the GNU Library Public +License version 2 can be found in ‘/usr/share/common-licenses/GPL-2’, +‘/usr/share/common-licenses/GFDL-1.2’ and ‘/usr/share/common-licenses/LGPL-2’ +respectively. + + +EMBOSS uses the libpcre and libplplot. + + +PCRE LICENCE +------------ + +PCRE is a library of functions to support regular expressions whose syntax +and semantics are as close as possible to those of the Perl 5 language. + +Written by: Philip Hazel + +University of Cambridge Computing Service, +Cambridge, England. Phone: +44 1223 334714. + +Copyright (c) 1997-2000 University of Cambridge + +Permission is granted to anyone to use this software for any purpose on any +computer system, and to redistribute it freely, subject to the following +restrictions: + +1. This software is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + +2. The origin of this software must not be misrepresented, either by + explicit claim or by omission. In practice, this means that if you use + PCRE in software which you distribute to others, commercially or + otherwise, you must put a sentence like this + + Regular expression support is provided by the PCRE library package, + which is open source software, written by Philip Hazel, and copyright + by the University of Cambridge, England. + + somewhere reasonably visible in your documentation and in any relevant + files or online help data or similar. A reference to the ftp site for + the source, that is, to + + ftp://ftp.csx.cam.ac.uk/pub/software/programming/pcre/ + + should also be given in the documentation. + +3. Altered versions must be plainly marked as such, and must not be + misrepresented as being the original software. + +4. If PCRE is embedded in any software that is released under the GNU + General Purpose Licence (GPL), then the terms of that licence shall + supersede any condition above with which it is incompatible. + + +PLPLOT LICENCE +-------------- + +The PLplot package may be distributed under the following terms: + + This library is free software; you can redistribute it and/or + modify it under the terms of the GNU Library General Public + License as published by the Free Software Foundation; either + version 2 of the License, or (at your option) any later version. + + This library is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU + Library General Public License for more details. + + You should have received a copy of the GNU Library General Public + License along with this library; if not, write to the Free Software + Foundation, Inc. 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA + + +AUTHORS OF EMBOSS +----------------- + +EMBOSS has been develped by many programmers, who are acknowledged it the +AUTHORS and THANK files in the original sources. These two files are reproduced +below: + + --- emboss-6.1.0.orig/debian/jemboss.desktop +++ emboss-6.1.0/debian/jemboss.desktop @@ -0,0 +1,10 @@ +[Desktop Entry] +Version=1.0 +Terminal=false +Icon=jemboss +Exec=runJemboss.csh +Name=Jemboss +GenericName=GUI for EMBOSS +Comment=Graphical user interface for the European Molecular Biology Open Software Suite. +Type=Application +Categories=Biology;Science;Education; --- emboss-6.1.0.orig/debian/README.debian +++ emboss-6.1.0/debian/README.debian @@ -0,0 +1,47 @@ +EMBOSS for Debian +================= + +Some programs renamed +--------------------- + +Some programs in EMBOSS have a name which is also used by other programs from +other packages. The Debian distribution does not allow two packages to conflict +in this way. Therfore 'cons' has been renamed 'em_cons' and 'pscan has been +renamed 'em_pscan'. + +There is a directory in which the program names are guaranteed to be always +unchanged, /usr/lib/emboss. You can prepend it to your PATH, with a command +such as 'PATH = /usr/lib/emboss:$PATH' with Bourne shells, so that when you run +'cons' or 'pscan', it is always the EMBOSS program. Other programs could be +renamed in the future, so it is strongly recommended to use this path in your +scripts. + + +tfm uses Debian's pager by default +---------------------------------- + +The `tfm' program will use /usr/bin/pager instead of /usr/bin/more by default. +/usr/bin/pager is managed via the `update-alternatives' utility and can point +to other pagers such as `less' and `most'. This can be overriden by using the +PAGER environment variable, just as in default EMBOSS installations. + + +EMBOSS Quick Guide relicenced +----------------------------- + +This packages contains a relicenced version of the EMBOSS Quick Guide. Its +uuencoded sources (in MS Word format) are included in the Debian source package +'emboss'. + + +Notes about how this package is tested +-------------------------------------- + +The EMBOSS packages for Debian are tested during the build process by running +the regression checks of the ‘test/qa/qatest.csh’ script. You can consult the +results in the build logs available at ‘http://buildd.debian.org/emboss’. In +addition, the packages are tested locally by the developper performing the +upload, by running a couple of very simple programs like ‘embossversion’ and +‘tfm’. + + -- Charles Plessy Fri, 07 Mar 2008 10:23:12 +0900 --- emboss-6.1.0.orig/debian/changelog +++ emboss-6.1.0/debian/changelog @@ -0,0 +1,382 @@ +emboss (6.1.0-5) unstable; urgency=low + + * The source package is now managed with Git (debian/control). + - VCS URLs updated in debian/control. + * debian/changelog: corrected an error on a progam name (vectorstrip). + * debian/patches/transient-vectorstrip.patch: keep quality scores. + * Two new patches not yet officialised: + - debian/patches/transient-vectorstrip.patch: retain quality scores. + - debian/patches/tfm-html.patch: corrects path to HTML documentation. + * Added Debian and FreeDesktop menu entries for Jemboss. + * Do not create a makefile when there is not at clean time (debian/rules). + * Documented how the package is tested in README.debian. + * Added various informations about Upstream in debian/upstream-metadata.yaml + + -- Charles Plessy Mon, 09 Nov 2009 20:39:28 +0900 + +emboss (6.1.0-4) unstable; urgency=low + + * New upstream patch (patch-1-2): + - Fix string extension so that pointers in lists remain valid. + - This fixes a bug in processing SwissProt complex descriptions. + - Fix definition of AJRESIZE0 macro. + - Fix processing of first match in a profile alignment (prophet). + * Delete /usr/share/EMBOSS/doc/programs/text/frestdist.txt, that + should belong to embassy-phylip (PHYLIPNEW). (debian/rules) + * Incremented Standards-Version in debian/control to reflect conformance + with Policy 3.8.3 (no changes needed). + * Removed the libtool libraries from the development packages (debian/rules). + + -- Charles Plessy Tue, 25 Aug 2009 23:19:10 +0900 + +emboss (6.1.0-2) unstable; urgency=low + + * New upstream patch (patch-1-1): + - Fix feature specification problems in Jemboss. + - Use version number to point to documentation URLs + - Remove standalone option from server script. + - Correct FASTQ input searching for '@' to start next sequence + - Standardize FASTQ sequence formats with other OpenBio projects + - Correct issues in igstrict, genpept and refseqp formats + * debian/control: + - Incremented Standards-Version to reflect conformance with Policy 3.8.2 + (no changes needed). + * debian/copyright.introduction: + - Use symbolic links to refer to relevant versions of the GNU licenses. + + -- Charles Plessy Sat, 01 Aug 2009 10:26:26 +0900 + +emboss (6.1.0-1) unstable; urgency=low + + * New upstream relase (Closes: #530112). + * Dropped patch against previous release. + * Created or refreshed the manpages. + + -- Charles Plessy Wed, 15 Jul 2009 23:15:26 +0900 + +emboss (6.0.1-11) unstable; urgency=low + + * New upstream patch (patch-1-12): + - Remove the 'aligned' attribute that was added in Fix 4. + - Fix crash if maxfragl > 40 selected. + - Update Entrez retrieval to cope with an extra line added + in the NCBI results. + - For phylogenetic applications (PHYLIPNEW) reading distance matrix files + failed for some formats written by other applications. Distance matrix + input now works for multiple matrices in square, upper-triangular and + lower-triangular formats. + + -- Charles Plessy Sun, 17 May 2009 14:51:05 +0900 + +emboss (6.0.1-10) unstable; urgency=low + + * New upstream patch (patch-1-8): + Incorrect information was often given in the subsidiary table + listing REs that would cut a greater number of times than an + optional user-supplied maximum number. The main role of + the program was unaffected. + + -- Charles Plessy Tue, 21 Apr 2009 13:01:38 +0900 + +emboss (6.0.1-9) unstable; urgency=low + + * New upstream patch (patch-1-7): + - Corrections on syntax using the master qualifier name as a suffix. + - Better support of the --without-x (not used in this package). + - Bug corrected for needle and water using the -nobrief option. + * debian/rules + - Corrected again the targets to avoid calling them when it is not + necessary. + - Defines emboss_acdroot, emboss_docroot and emboss_data in order + to run the tests. + + -- Charles Plessy Wed, 08 Apr 2009 20:20:58 +0900 + +emboss (6.0.1-8) unstable; urgency=low + + * debian/rules: + - Do not pass java options to the configure script if openjdk is not + installed (Closes: #521996, thanks to Peter Green). + - Recursive removal of emboss_tmp (to build the package twice in a row). + - Removed one `dh binary-indep` instance that strangely sneaked in after + running `svn update`. + * debian/control: + - Moved again openjdk-6-jdk to Build-Depends-Indep. + - Added debhelper's ${misc:Depends} substitution variable to the packages + that did not already depend on it. + + -- Charles Plessy Tue, 31 Mar 2009 14:26:55 +0900 + +emboss (6.0.1-7) unstable; urgency=low + + * debian/control: moved openjdk-6-jdk to Build-Depends. + Apologies to buildd administrators. (Closes: #521912). + + -- Charles Plessy Tue, 31 Mar 2009 08:34:59 +0900 + +emboss (6.0.1-6) unstable; urgency=low + + * debian/rules: + - Build arch all packages only when binary-indep is called + (Closes: #521398) + - Corrected stamping gymnastics. + * debian/control: moved openjdk-6-jdk to Build-Depends-Indep + + -- Charles Plessy Mon, 30 Mar 2009 13:02:11 +0900 + +emboss (6.0.1-5) unstable; urgency=low + + * New upstream patch (patch-1-6): correction for large pairwise alignments. + * debian/control: + - Incremented Standards-Version to reflect conformance with Policy 3.8.1 + (no changes needed). + - Moved the bibliographic reference from the description of the EMBOSS + package to the file debian/reference. + + -- Charles Plessy Wed, 25 Mar 2009 11:44:30 +0900 + +emboss (6.0.1-4) unstable; urgency=low + + * New upstream patch (patch-1-5): + - removes unnecessary whitespaces in edialign.acd. + - saves Citations and comments in EMBL/GenBank formats for each new + entry processed. + * debian/control: + - Uses the official homepage URL as confirmed by Upstream. + - Redundant section field removed for jemboss. + - Description corrected for libnucleus6-dev. + * debian/rules: + - Pass --bindir=/usr/lib/emboss directly instead of moving files. + - Hardcode AJAX_FIXED_ROOT to /usr/share/EMBOSS (Closes: #487539). + - Replaced `dh_clean -k', deprecated, by dh_prep. + * debian/emboss.dir, debian/emboss.install: simplified after reworking + the installation of the binaries and their symbolic links. + + -- Charles Plessy Sun, 22 Feb 2009 22:53:55 +0900 + +emboss (6.0.1-3) experimental; urgency=low + + * New upstream patch (patch-1-3). + - fixes segmentation fault in vectorstrip when -auto is used with empty + vectorsfile. + - adds '.' trailer to the OS line in SwissProt output. + * debian/rules: corrected the section of the manual pages of the renamed + programs from 1 to 1e (Closes: #503733). + * Preliminary support for jEMBOSS: + - Build-Depend on openjdk-6-jdk (debian/control). + - New package "jemboss", depending on openjdk-6-jre (debian/control). + - The jemboss package contains everything installed by the command + `make -C jemboss install' (debian/rules). + + -- Charles Plessy Wed, 26 Nov 2008 08:57:20 +0900 + +emboss (6.0.1-2) experimental; urgency=low + + * New upstream patch (patch-1-1). + - jaspscan can now scan multiple sequences. + - "digest -allpartials" now reports all C-term fragments. + + -- Charles Plessy Wed, 27 Aug 2008 22:11:45 +0900 + +emboss (6.0.1-1) experimental; urgency=low + + * New upstream release: + - New applications: aligncopy, aligncopypair, consambig, density, + featcopy, featreport, infobase, inforesidue, jaspextract, jaspscan, + maskambignuc, maskambigprot, nohtml, nospace, notab, sizeseq, + skipredundant, trimspace. + - See `/usr/share/doc/emboss/changelog.gz' for more details. + * debian/patches: + - Removed the patches that are obsoleted by the new release. + - Documented the local patch on `tfm' that changes default pager. + * debian/README.source added to document how to patch and unpatch the + sources. + * debian/emboss-doc.doc-base.{apps/groups} corrected for new file locations. + * debian/control: + - Replaced build dependency on deprecated x-dev by x11proto-core-dev. + - Uses debhelper 7. + - Incremented the soname of the AJAX and NUCLEUS libraries (conflict and + replace the previous versions). + - Incremented Standards-Version to 3.8.0 after adding README.Sources. + - Added a new package, emboss-test, that contains test data. + - Build-Depends: tcsh | csh | c-shell to run the tests. + * debian/rules: + - Implemented build-time tests. + - Updated the instructions to build manpages. + + -- Charles Plessy Thu, 17 Jul 2008 14:07:40 +0900 + +emboss (5.0.0-7) unstable; urgency=low + + * Changed the doc-base section according to the new policy. + * Updated my email address. + * Updated the contact address in the manpages. + + -- Charles Plessy Fri, 16 May 2008 19:58:37 +0900 + +emboss (5.0.0-6) unstable; urgency=low + + * New bugfixes released upstream: + - Fixes failure on some databases if the PAGESIZE was set large + and the CACHESIZE was set small. + - Platform-independence modifications added. + * debian/README.Debian: described the change of default pager for tfm. + + -- Charles Plessy Fri, 07 Mar 2008 10:15:31 +0900 + +emboss (5.0.0-5) unstable; urgency=low + + * New bugfixes released upstream. + - Fixes changed ID format in GCG databases. + - Fixes reading from PIR databases. + - Fixes a problem with O in protein sequences for pyrrolysine. + - Fixes a problem in GENBANK output format. + - Fixes a problem in reading protein sequences from Staden + "spin" interface. + - Fixes tokens that are longer than the maximum length. + - debian/patches now uses the monolithic upstream patch instead of + file-per-file fixes. You can find longer explanations in the header + of debian/patches/patch-1-3. + + -- Charles Plessy Sat, 01 Mar 2008 11:46:26 +0900 + +emboss (5.0.0-4) unstable; urgency=low + + * debian/patches: + - using-pager-in-tfm.patch: + Patching tfm so that it uses the alternatives system `/usr/bin/pager' + if the `PAGER' environment variable is not defined. + - embindex-fix-2008-01-19.patch: + Official fix 3. EMBOSS-5.0.0/nucleus/embindex.c 18 Jan 2008. + Order and fill fixes to sort out potential problems with kw/de/tx + indexes. + + -- Charles Plessy Wed, 23 Jan 2008 20:56:22 +0900 + +emboss (5.0.0-3) unstable; urgency=low + + [ Nelson A. de Oliveira ] + * Using bzip2 compression for packages. This saves about 832KB of space. + + [ Charles Plessy ] + * debian/patches/ajindex-fix-2008-01-09.patch: + - Fixes rare secondary index problem with input files over 2Gb. + * debian/control: + - Swiched maintainership to the Debian-Med packaging team. + - Relocated the package to the Debian-Med Subversion repository. + - Allowed upload by Debian Maintainers. + - Checked that the package is compliant to Policy 3.7.3 + - Added dialign again to the Recommends: field. It only disapperared from + the documentation; the edialign program is still there. + - -dev packages now depend on their corresponding libraries. + - Replaced occurences of $(source:Version} by ${binary:Version} to make + the packages binNMU safe. + - emboss-data and emboss-doc do not Suggest: emboss anymore. + - Changed the description of libajax5 and libnucleus5 so that they are not + identical. + - Removed the XS- prefix in the Vcs fields. + - Build-depends on autotools-dev. + * debian/rules: + - Removes Makefiles ignored by make distclean in the test directory. + - Uses config.(sub|guess) from the autotools-dev package. + + -- Charles Plessy Thu, 10 Jan 2008 21:27:31 +0900 + +emboss (5.0.0-2) unstable; urgency=low + + [ Charles Plessy ] + * Using a emboss/psiphi.c file fixed by upstream + ftp://emboss.open-bio.org/pub/EMBOSS/fixes/psiphi.c + * Documentation: + - Building the manpages offline to save buildd time, therefore not + depending anymore on the XML toolchain. + - Added a "e" suffix to the manpages, to avoid conflicts. + (Closes: #427439) + - Linked /usr/share/emboss-doc/doc/ to /usr/share/EMBOSS/docs, and + registered documentation in doc-base. (Closes: #423941) + * Gave their own packages to the AJAX and NUCLEUS libraries. + - Header files are in /usr/include/ajax and /usr/include/nucleus. + - The private pcre files are kept under /usr/include/ajax. (Closes: #433316) + * Packaging: + - Removed the extra Tag field in debian/control. + - Removed the recommendation on dialign, as edialign disappeared. + - Tightened the Depends: relationship between emboss and + emboss-lib (Closes: #435232). + - Removed inactive developer from the uploaders list. + - Suggests: embassy. + * Temporarly incorporates a relicenced version of the EMBOSS Quick + Guide, until it becomes part of the original tarball. Its sources + are shipped uuencoded, therfore emboss now build-depends on sharutils. + + [ Nelson A. de Oliveira ] + * Checked and fixed clean target. (Closes: #442554). + + -- Charles Plessy Sat, 13 Oct 2007 15:05:53 +0900 + +emboss (5.0.0-1) unstable; urgency=low + + * New upstream version + * Renaming cons and pscan to em_cons and em_pscan, see README.Debian + for more information. + * Moved all the binaries to /usr/lib/emboss. /usr/bin contains only + symbolic links (Closes : #427439, #427440). + * Makes sure that there is a Makefile befor invoking the clean rule. + * Added /etc/emboss/embossrc.d directory for future modular + configuration. + * Swiched from dpatch to quilt (no patches for the moment). + * Build-depend on libemboss-acd-perl to generate manpages with + acd2docbook.pl, written especially for this package (Closes: #423938). + * Adding a placeholder file to force the includion of debian/manpages. + * Removing the entries in the Debian menu until we agree that we + want them. + + -- Charles Plessy Thu, 19 Jul 2007 13:56:11 +0900 + +emboss (4.1.0-1) experimental; urgency=low + + * New maintainer and uploaders + * First official relase (Closes: #156276) + * Xlib transition. + * Using dpatch and /usr/share/dpatch/dpatch.make to manage patches. + * Added XS-Vcs entries in debian/changelog. + * Removed the pcre includes from the emboss-libs package. + * Fixed watch file. + * Emboss Recommends:dialign and Suggests:clustalw. + + -- Charles Plessy Mon, 12 Mar 2007 08:26:15 +0900 + +emboss (2.8.0-2) unstable; urgency=low + + * Fixed manpages being in both emboss and emboss-lib + * Removed circ.dep. emboss <-> emboss-lib + + -- Matt Hope Fri, 21 May 2004 12:47:47 +1000 + +emboss (2.8.0-1) unstable; urgency=low + + * New upstream release + + -- Matt Hope Fri, 5 Dec 2003 15:08:54 +1100 + +emboss (2.7.1-1) unstable; urgency=low + + * New upstream release + * emboss-lib + - Fixed the shlibs. + + -- Matt Hope Mon, 7 Jul 2003 14:36:14 +1000 + +emboss (2.6.0-1) unstable; urgency=low + + * New upstream release + + -- Matt Hope Fri, 7 Apr 2003 21:41:12 +1000 + +emboss (2.4.1-1) unstable; urgency=low + + * Initial package. + Thanks for the feedback from everyone. + (Closes: Bug#156276 ITP) + + -- Matt Hope Sat, 6 Jul 2002 01:11:17 +1000 + --- emboss-6.1.0.orig/debian/abiview.desktop +++ emboss-6.1.0/debian/abiview.desktop @@ -0,0 +1,16 @@ +[Desktop Entry] +Version=1.0 +Terminal=false +#Icon=abiview +Exec=abiview -outseq /dev/null -graph x11 %f +Name=abiview +GenericName=Chromatogram viewer +GenericName[en]=Chromatogram viewer +GenericName[fr]=Visualisateur de chromatogrammes +Comment=Displays ABIF Applied Biosystems Inc. chromatograms. +Comment[en]=Displays ABIF Applied Biosystems Inc. chromatograms. +Comment[fr]=Affiche les chromatogrammes au format ABIF (Applied Biosystems Inc.). +Type=Application +Categories=Biology;Science;Education; +MimeType=application/vnd.appliedbiosystems.abif; +NoDisplay=true --- emboss-6.1.0.orig/debian/emboss.sharedmimeinfo +++ emboss-6.1.0/debian/emboss.sharedmimeinfo @@ -0,0 +1,21 @@ + + + + + + ABIF chromatogram + + + ABIF + Applied Biosystems, Inc. Format + + + + + + + + --- emboss-6.1.0.orig/debian/compat +++ emboss-6.1.0/debian/compat @@ -0,0 +1 @@ +7 --- emboss-6.1.0.orig/debian/libnucleus6-dev.dirs +++ emboss-6.1.0/debian/libnucleus6-dev.dirs @@ -0,0 +1,2 @@ +usr/lib +usr/include --- emboss-6.1.0.orig/debian/EMBOSS_qg.doc.uu +++ emboss-6.1.0/debian/EMBOSS_qg.doc.uu @@ -0,0 +1,1460 @@ +begin 644 EMBOSS_qg.doc +MT,\1X*&Q&N$`````````````````````/@`#`/[_"0`&```````````````! +M````>P``````````$```?0````$```#^____`````'H```#_____________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M_______________________LI<$`!V$)!```\!*_```````!$0`!``$`!@`` +M3B\```X`:F)J8H0LA"P````````````````````````)!!8`DG4``.Y.``#N +M3@``3BD```````````````````````````````````````#__P\````````` +M``#__P\```````````#__P\``````````````````````(@``````#8#```` +M````-@,``#8#````````-@,````````V`P```````#8#````````-@,``!0` +M`````````````*X#````````UC4```````#6-0```````-8U````````UC4` +M`"P````"-@``3````*X#````````OT<``'@!``!:-@```````%HV```````` +M6C8```````!:-@```````%HV````````6C8```````!:-@```````%HV```` +M````-D<```(````X1P```````#A'````````.$<````````X1P```````#A' +M````````.$<``"P````W20``4@(``(E+``!.````9$<``!4````````````` +M````````````-@,```````!:-@````````````````````````````!:-@`` +M`````%HV````````6C8```````!:-@```````&1'````````-D<````````V +M`P```````#8#````````6C8``````````````````%HV````````>4<``!8` +M```V1P```````#9'````````-D<```````!:-@``)@@``#8#````````6C8` +M```````V`P```````%HV````````-D<``````````````````#9'```````` +M2@,``"0```!N`P``0````#8#````````-@,````````V`P```````#8#```` +M````6C8````````V1P``````````````````-D<``````````````````#9' +M````````-@,````````V`P`````````````````````````````````````` +M````````````````````````````````````````````-D<````````````` +M`````$XV```,````-D0QPP```````````````-8U````````@#X``+8(```V +M1P``````````````````-D<```````"/1P``,````+]'````````-D<````` +M``#72P```````#9'````````UTL````````V1P```````#9'```````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````V`P`````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M`````````````````````````````````*X#````````K@,``,0>``!R(@`` +M9!,```````````````````````"N`P```````*X#````````2!/<&5N(%-O9G1W87)E(%-U:71E +M#0U(:7-T;W)Y#5-I;F-E(#$Y.#@L('1H92!S97%U96YC92!A;F%L>7-I2!N +M97<@9V5N97)A=&EO;B!O9B!A8V%D96UI8R!S97%U96YC92!A;F%L>7-I6EN9RP-;6]D:69I8V%T:6]N(&%N +M9"!D:7-T7-T96T-861M:6YI6]U2!T>7!E6]U#7=I;&P@8F4@<')O;7!T960@:68@>6]U('5S92!T:&4@EF]P=&EO;B!Q +M=6%L:69I97(N($%L;"!T:&5S90UQ=6%L:69I97)S(&AA=F4@9&5F875L="!V +M86QU97,N#4%D=F%N8V5D(%%U86QI9FEE7!E7!E($%L;&]W960@=F%L=65S#6)O;VP@ +M>65S.B`M<&%R86T@;F\Z("UN;W!A"!F;W(@ +M86QI9VYM96YT6=R87!H(&]U='!U +M="!D979I8V4@9F]R(%A9(&=R87!H2!O9B!T:&5S92X-#D%S'1E;G-I;VX@6=R87!H#2UG<')O;7!T(&)O;VP@9W)A<&@@<')O;7!T:6YG +M#2UG=&ET;&4@'1I=&QE('-T3(I('1I=&QE#2UG<&%G97,@:6YT96=E2!I;F9O61O="!S=7!E2!O9B!P;W1E;G1I86P@3U)&"!A;F0@2VT@8V%L8W5L871I;VYS#69U>GIP2!%34)/4U,-#4EN=&5L;&E'96YE=&EC2!A;F0@:7,@8V]P>7)I9VAT($1R($1A +M=FED#4UA2!B92!C;W!I960@86YD +M(&1I#0``0`X``%X.``!B#@``<0X``*8.``"N +M#@``VPX``.0.```L#P``,P\``&4/``!R#P``XP\``.H/``!W$```FQ```-40 +M``#=$```]1```/X0```$$0``#A$``#81```\$0``;A$``(<1``"*$@``GQ(` +M`!\3``#GSK6>M9ZUGH>UA[6>M9YNGK6>;IYNGK6>;IZUGK6>M9ZUGK6>M9ZU +MGK6>`#`5:($3;``6:)(XX@`V"(%"*@%#2A(`3TH#`%%*`P!A2A(`;4@)!'!H +M`````'-("00`+15H@1-L`!9HDCCB`$(J`D-*$@!/2@,`44H#`&%*$@!M2`D$ +M<&@``/\`"P``;PL``*H+``#D +M"P``"PP``/0```````````````#T````````````````]``````````````` +M`/0```````````````#T````````````````]````````````````/0````` +M``````````#T````````````````]````````````````/0````````````` +M``#T````````````````]````````````````/0```````````````#T```` +M````````````]````````````````/0```````````````#T```````````` +M````]````````````````/0```````````````#T````````````````]``` +M`````````````/0```````````````#T````````````````]``````````` +M`````/0```````````````#T````````````````]````````````````/0` +M```````````````````````````*```Q)``W)``X)`!()`!G9)(XX@``'``& +M``!.+P``_@`````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````"`0$!"PP``!H,``!.#```B0P``,@,```�``-0T``&\- +M``"N#0``N@T``-X-```;#@``0`X``%X.``!Q#@``*@\``#,/``!A#P``G`\` +M`-D/```5$```3A```'<0``"+$```FQ```-40```$$0``(Q$``#81``#T```` +M````````````]````````````````/0```````````````#T```````````` +M````]````````````````/0```````````````#T````````````````]``` +M`````````````/0```````````````#T````````````````]``````````` +M`````/0```````````````#T````````````````]````````````````/0` +M``````````````#T````````````````]````````````````/0````````` +M``````#T````````````````]````````````````/0```````````````#T +M````````````````]````````````````/0```````````````#T```````` +M````````]````````````````/0```````````````#T```````````````` +M````````````"@``,20`-R0`."0`2"0`9V22..(``!PV$0``5A$``&P1``"' +M$0``P!$``.P1```I$@``8Q(``(H2``"?$@``V1(``!D3```?$P``21,``'03 +M``"($P``O1,``.L3```'%```-Q0``$84``!Z%```B!0``+44``#&%```W!0` +M``86```;%@``EA8``/0```````````````#T````````````````]``````` +M`````````/0```````````````#T````````````````]``````````````` +M`/0```````````````#T````````````````]````````````````/0````` +M``````````#T````````````````]````````````````/0````````````` +M``#T````````````````]````````````````/0```````````````#T```` +M````````````]````````````````/0```````````````#T```````````` +M````]````````````````/0```````````````#T````````````````]``` +M`````````````/0```````````````#T````````````````]``````````` +M`````/0````````````````````````````*```Q)``W)``X)`!()`!G9)(X +MX@``'!\3```E$P``8!,``&D3``"($P``D1,``+T3``##$P``!Q0```T4``!& +M%```3A0``(@4``"0%```QA0``-P4``#@%```YA0``'P5``"%%0``!A8``!L6 +M``"0%@``JA8``.T6``#U%@``*A<``#X7``"G%P``OA<``-(7``#7%P``W!<` +M`.,7``#G%P``^!<```88```5&```)1@``#<8``!,&```91@``((8``")&``` +MF!@``+08``##&```RA@``/`8``#X&```%AD``!P9```N&0``11D``(H9``"3 +M&0``H1D``*89``"V&0``P!D``-H9``#B&0``"!H```\:```C&@``+1H``$\: +M``!9&@``@AH``(H:``"?&@``I1H``,<:``#/&@``&!L``.?0Y]#GT.?0Y]#G +MT.?0Y]#GT.?0Y]#GT.?0Y]#GT.?0Y]#GT.?0Y]#GT.?0Y]#GT.?0Y]#GT.?0 +MY]#GT.?0Y]#GT.?0Y]#GT.?0```````````````````````````````````` +M````````````````````+15H@1-L`!9HDCCB`$(J`4-*$@!/2@,`44H#`&%* +M$@!M2`D$<&@```````!H +M'@``B1X``*H>``#*'@``]````````````````/0```````````````#L```` +M````````````]````````````````/0```````````````#T```````````` +M````]````````````````/0```````````````#T````````````````]``` +M`````````````/0```````````````#T````````````````]``````````` +M`````/0```````````````#T````````````````]````````````````/0` +M``````````````#T````````````````]````````````````/0````````` +M``````#T````````````````]````````````````/0```````````````#T +M````````````````]````````````````/0```````````````#T```````` +M``````````````````````<``#$D`#!L``)4;``"?&P``N1L` +M`+\;``#E&P``\AL``!(<```<'```.1P``$$<``!A'```:1P``(D<``"2'``` +MKQP``+H<``#0'```V1P``.X<``#V'```&1T``!X=```Y'0``0AT``%D=``!R +M'0``C1T``)<=``"U'0``PAT``-P=``#D'0``^1T```,>```?'@``*1X``$X> +M``!4'@``:!X``'(>``")'@``D1X``*H>``#3'@``ZAX``/4>```.'P``%!\` +M`"0?```R'P``-A\``$```.'P``/Q\``&H? +M``".'P``P!\``-\?``#_'P``(B```$D@``!A(```BR```+$@``#/(```ZB`` +M``LA```H(0``12$``&LA``"+(0``K"$``,$A``#Z(0``6B(``'$B``#=(@`` +M_"(``!HC``#T````````````````]````````````````/0````````````` +M``#T````````````````]````````````````/0```````````````#T```` +M````````````]````````````````/0```````````````#T```````````` +M````]````````````````/0```````````````#T````````````````]``` +M`````````````/0```````````````#T````````````````]``````````` +M`````/0```````````````#T````````````````]````````````````/0` +M``````````````#T````````````````]````````````````/0````````` +M``````#T````````````````]````````````````/0```````````````#T +M````````````````````````````"@``,20`-R0`."0`2"0`9V22..(``!QK +M(```BR```+H@``#/(```UR```.H@``#U(```"R$``!0A```H(0``,2$``$4A +M``!.(0``:R$``',A``"+(0``E2$``*PA``#!(0``6B(``'$B``#\(@``!",` +M`!HC```E(P``:",``&PC``"/(P``E",``*HC``"O(P``_2,```4D```U)``` +M/20``%LD``!E)```RB0``,XD``#/)```UB0``-HD```+)0``)24``"PE``!* +M)0``9"4``)(E``"F)0``YB4``.XE```2)@``'B8``$(F``!-)@``;28``'0F +M``"4)@``G28``,8F``#.)@``\R8``/PF```D)P``/R<``&(G``!H)P``BB<` +M`)0G``"V)P``OB<``-\G``#Q)P``Z,_HS^C/Z,_HS^C/Z,_HS^C/Z,_HS^C/ +MZ,_HS^C/Z,_HS^C/Z+;HMNC/Z,_HS^C/Z,_HS^C/Z,_HS^C/Z,_HS^C/Z,_H +MS^C/,!5H@1-L`!9HDCCB`#8(@4(J`4-*$@!/2@,`44H#`&%*$@!M2`D$<&@` +M````*``` +MXB@```DI```1*0``+2D``$DI``!I*0``?"D``)$I``"D*0``QBD``,XI``#C +M*0``ZRD```PJ```4*@``)RH``"XJ``!2*@``<"H``(XJ``"8*@``N"H``+\J +M``#5*@``W"H``/4J``#]*@``%"L``!PK```\*P``2RL``&TK``"`*P``G"L` +M`+(K``#=*P``Y2L```(L```4+```*"P``#$L``!5+```Y2P``,PM``#G+0`` +MU2X``$PO``!-+P``3B\``.C/Z,_HS^C/Z,_HS^C/Z,_HS^C/Z,_HS^C/Z,_H +MS^C/Z,_HS^C/Z,_HS^C/Z,_HS^C/Z,_HN.BXZ+0````````````````````` +M```````````````````````````````````````````````````````````` +M```````&%FB2..(``"T5:($3;``6:)(XX@!"*@)#2A(`3TH#`%%*`P!A2A(` +M;4@)!'!H``#_`'-("00P%6B!$VP`%FB2..(`-0B!0BH!0TH2`$]*`P!12@,` +M84H2`&U("01P:`````!S2`D$`"T5:($3;``6:)(XX@!"*@%#2A(`3TH#`%%* +M`P!A2A(`;4@)!'!H`````'-("00`.FTK``"<*P``I2L``-TK```"+```*"P` +M`%4L``!6+```=RP``'@L``"O+```Y2P``.8L```@+0``?"T``+@M``#G+0`` +MB"X``,4N``#K+@``["X``$PO``!-+P``3B\``/0```````````````#T```` +M````````````]````````````````/0```````````````#T```````````` +M````]````````````````/0```````````````#T````````````````]``` +M`````````````/0```````````````#T````````````````]``````````` +M`````/0```````````````#T````````````````]````````````````/0` +M``````````````#T````````````````]````````````````/0````````` +M``````#T````````````````]````````````````/(```````````````#R +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M`````````````````0````H``#$D`#P```8 +ML```"U`"`%@C``P``P```2P!+``````)3`U/_\__S0E^#8$#905[`^```@`` +M`$@`2``````"V`(H``$```!D`````0`#`P,````!?_\``0`!```````````` +M````:`@`&0&0```````@```````````````````````````````````\/WAM +M;"!V97)S:6]N/2(Q+C`B(&5N8V]D:6YG/2)55$8M."(_/@H\(41/0U194$4@ +M<&QI3YC;VTN87!P;&4N<')I;G0N4&%G949O3YC;VTN87!P;&4N<')I;G0N=&EC:V5T +M+F-R96%T;W(\+VME>3X*"0D\3X*"0D)"3QS=')I;F<^;&%S97)?-34P,%]O;E]H<#4U,#`N8V]M<&)I +M;RYD=6YD964N86,N=6L\+W-T3X*"0D)"3QD871E/C(P,#3YC;VTN87!P;&4N<')I;G0N +M=&EC:V5T+G-T871E1FQA9SPO:V5Y/@H)"0D)/&EN=&5G97(^,#PO:6YT96=E +M3YC;VTN87!P;&4N<')I;G0N=&EC:V5T+F-R96%T;W(\ +M+VME>3X*"0D\F]N=&%L4F5S/"]K97D^"@D)"0D\ +M3YC;VTN87!P;&4N<')I +M;G0N4&%G949O3YC;VTN87!P;&4N<')I;G0N=&EC:V5T+F-L:65N +M=#PO:V5Y/@H)"0D)/'-T3X*"3PO9&EC=#X*"3QK97D^8V]M+F%P<&QE+G!R:6YT+E!A9V5& +M;W)M870N4$U38V%L:6YG/"]K97D^"@D\9&EC=#X*"0D\:V5Y/F-O;2YA<'!L +M92YP3YC;VTN87!P;&4N<')I;G0N4&%G949O3YC;VTN87!P;&4N +M<')I;G0N4&%G949O3YC;VTN87!P;&4N<')I;G0N=&EC:V5T+F-R96%T;W(\+VME +M>3X*"0D\3X*"0D)"3QR +M96%L/C$\+W)E86P^"@D)"0D\:V5Y/F-O;2YA<'!L92YP3YC;VTN87!P;&4N<')I;G0N +M3YC;VTN87!P;&4N<')I;G0N +M=&EC:V5T+FET96U!3PO:V5Y/@H)"0D\87)R87D^"@D)"0D\9&EC=#X* +M"0D)"0D\:V5Y/F-O;2YA<'!L92YP3X*"0D)"0D)/')E86P^,"XP +M/"]R96%L/@H)"0D)"0D\3YC;VTN +M87!P;&4N<')I;G0N=&EC:V5T+F-L:65N=#PO:V5Y/@H)"0D)"3QS=')I;F<^ +M8V]M+F%P<&QE+G!R:6YT:6YG;6%N86=E3YC;VTN +M87!P;&4N<')I;G0N=&EC:V5T+G-T871E1FQA9SPO:V5Y/@H)"0D)"3QI;G1E +M9V5R/C`\+VEN=&5G97(^"@D)"0D\+V1I8W0^"@D)"3PO87)R87D^"@D)/"]D +M:6-T/@H)"3QK97D^8V]M+F%P<&QE+G!R:6YT+E!A9V5&;W)M870N4$U!9&IU +M3YC;VTN87!P +M;&4N<')I;G0N=&EC:V5T+FET96U!3PO:V5Y/@H)"0D\87)R87D^"@D) +M"0D\9&EC=#X*"0D)"0D\:V5Y/F-O;2YA<'!L92YP3X*"0D)"0D\87)R87D^"@D)"0D) +M"3QR96%L/BTT.2XV-C8U.34T-3@Y.#0S-S4\+W)E86P^"@D)"0D)"3QR96%L +M/BTU,2XS,S,S-C,X-3`Y,3$T-C$\+W)E86P^"@D)"0D)"3QR96%L/C(T,CDN +M-3`P,#3YC;VTN87!P +M;&4N<')I;G0N=&EC:V5T+F-L:65N=#PO:V5Y/@H)"0D)"3QS=')I;F<^8V]M +M+F%P<&QE+G!R:6YT:6YG;6%N86=E3YC;VTN87!P +M;&4N<')I;G0N=&EC:V5T+G-T871E1FQA9SPO:V5Y/@H)"0D)"3QI;G1E9V5R +M/C`\+VEN=&5G97(^"@D)"0D\+V1I8W0^"@D)"3PO87)R87D^"@D)/"]D:6-T +M/@H)"3QK97D^8V]M+F%P<&QE+G!R:6YT+E!A<&5R26YF;RY034-U3X*"0D)"3QD:6-T/@H) +M"0D)"3QK97D^8V]M+F%P<&QE+G!R:6YT+E!A<&5R26YF;RY034-U3YC;VTN87!P +M;&4N<')I;G0N=&EC:V5T+FUO9$1A=&4\+VME>3X*"0D)"0D\9&%T93XR,#`W +M+3$P+3`Y5#$P.C0X.C,R6CPO9&%T93X*"0D)"0D\:V5Y/F-O;2YA<'!L92YP +M3X*"0D\+V1I8W0^"@D) +M/&ME>3YC;VTN87!P;&4N<')I;G0N4&%P97));F9O+E!-4&%P97).86UE/"]K +M97D^"@D)/&1I8W0^"@D)"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME="YC +M3X*"0D)"3QD:6-T/@H)"0D)"3QK +M97D^8V]M+F%P<&QE+G!R:6YT+E!A<&5R26YF;RY035!A<&5R3F%M93PO:V5Y +M/@H)"0D)"3QS=')I;F<^:7-O+6$T/"]S=')I;F<^"@D)"0D)/&ME>3YC;VTN +M87!P;&4N<')I;G0N=&EC:V5T+F-L:65N=#PO:V5Y/@H)"0D)"3QS=')I;F<^ +M8V]M+F%P<&QE+G!R:6YT:6YG;6%N86=E3YC;VTN +M87!P;&4N<')I;G0N=&EC:V5T+G-T871E1FQA9SPO:V5Y/@H)"0D)"3QI;G1E +M9V5R/C$\+VEN=&5G97(^"@D)"0D\+V1I8W0^"@D)"3PO87)R87D^"@D)/"]D +M:6-T/@H)"3QK97D^8V]M+F%P<&QE+G!R:6YT+E!A<&5R26YF;RY0355N861J +M=7-T961086=E4F5C=#PO:V5Y/@H)"3QD:6-T/@H)"0D\:V5Y/F-O;2YA<'!L +M92YP3YC;VTN87!P +M;&4N<')I;G0N=&EC:V5T+FET96U!3PO:V5Y/@H)"0D\87)R87D^"@D) +M"0D\9&EC=#X*"0D)"0D\:V5Y/F-O;2YA<'!L92YP3X*"0D)"0D\87)R87D^"@D)"0D) +M"3QR96%L/C`N,#PO3X*"0D)"3QD:6-T/@H)"0D)"3QK97D^8V]M+F%P<&QE+G!R:6YT +M+E!A<&5R26YF;RY0355N861J=7-T961087!E3X*"0D)"0D\ +M87)R87D^"@D)"0D)"3QR96%L/BTQ,BXS,C`P,#3X*"0D)"3QD:6-T/@H)"0D)"3QK97D^8V]M+F%P<&QE +M+G!R:6YT+E!A<&5R26YF;RYP<&0N4$U087!E3X*"0D)"0D\ +M3YC;VTN87!P;&4N<')I;G0N +M=&EC:V5T+G-T871E1FQA9SPO:V5Y/@H)"0D)"3QI;G1E9V5R/C$\+VEN=&5G +M97(^"@D)"0D\+V1I8W0^"@D)"3PO87)R87D^"@D)/"]D:6-T/@H)"3QK97D^ +M8V]M+F%P<&QE+G!R:6YT+G1I8VME="Y!4$E697)S:6]N/"]K97D^"@D)/'-T +M3YC;VTN +M87!P;&4N<')I;G0N=&EC:V5T+G1Y<&4\+VME>3X*"0D\ +M!P``&P@``$`(``!>"```<0@``"H)```S"0``80D``)P)``#9"0``%0H``$X* +M``!W"@``BPH``)L*``#5"@``!`L``",+```V"P``5@L``&P+``"'"P``P`L` +M`.P+```I#```8PP``(H,``"?#```V0P``!D-```?#0``20T``'0-``"(#0`` +MO0T``.L-```'#@``-PX``$8.``!Z#@``B`X``+4.``#&#@``W`X```80```; +M$```EA```,T0```*$0``*A$``%T1``"9$0``IQ$``+X1``#2$0``\!$```\2 +M```Q$@``7A(``((2``"M$@``PQ(``/`2```6$P``+A,``(H3``"A$P``MA,` +M`-H3```(%```(Q0``$\4``""%```GQ0``,<4``#K%```&14``$H5``!R%0`` +ME14``+D5``#E%0``$A8``#D6``!A%@``B18``*\6``#0%@``[A8``!D7```Y +M%P``61<``(T7``"U%P``W!<``/D7```?&```3A@``&@8``")&```JA@``,H8 +M``#J&```#AD``#\9``!J&0``CAD``,`9``#?&0``_QD``"(:``!)&@``81H` +M`(L:``"Q&@``SQH``.H:```+&P``*!L``$4;``!K&P``BQL``*P;``#!&P`` +M^AL``%H<``!Q'```W1P``/P<```:'0``2QT``&@=``"/'0``JAT``/T=```U +M'@``6QX``'\>``"R'@``Y1X``/H>```"'P``)1\``$H?``!='P``DA\``-$? +M``#F'P``$B```$(@``!M(```E"```,8@``#S(```)"$``#@A``!B(0``BB$` +M`+8A``#?(0``YB$``/$A```7(@``12(``(4B``":(@``O2(``-XB```)(P`` +M+2,``$,C``!I(P``D2,``,8C``#C(P``#"0``" +M@`"8`````#``````````@````(````"0````RH``F``````P`````````(`` +M``"`````D````,J``)@`````,`````````"`````@````)````#*@`"8```` +M`#``````````@````(````"0````RH``F``````P`````````(````"````` +MD````,J``)@`````,`````````"`````@````)````#*@`"8`````#`````` +M````@````(````"0````RH``F``````P`````````(````"`````D````,J` +M`)@`````,`````````"`````@````)````#*@`"8`````#``````````@``` +M`(````"0````RH``F``````P`````````(````"`````D````,J``)@````` +M,`````````"`````@````)````#*@`"8`````#``````````@````(````"0 +M````RH``F``````P`````````(````"`````D````,J``)@`````,``````` +M``"`````@````)````#*@`"8`````#``````````@````(````"0````RH`` +MF``````P`````````(````"`````D````,J``)@`````,`````````"````` +M@````)````#*@`"8`````#``````````@````(````"0````RH``F``````P +M`````````(````"`````D````,J``)@`````,`````````"`````@````)`` +M``#*@`"8`````#``````````@````(````"0````RH``F``````P```````` +M`(````"`````D````,J``)@`````,`````````"`````@````)````#*@`"8 +M`````#``````````@````(````"0````RH``F``````P`````````(````"` +M````D````,J``)@`````,`````````"`````@````)````#*@`"8`````#`` +M````````@````(````"0````RH``F``````P`````````(````"`````D``` +M`,J``)@`````,`````````"`````@````)````#*@`"8`````#`````````` +M@````(````"0````RH``F``````P`````````(````"`````D````,J``)@` +M````,`````````"`````@````)````#*@`"8`````#``````````@````(`` +M``"0````RH``F``````P`````````(````"`````D````,J``)@`````,``` +M``````"`````@````)````#*@`"8`````#``````````@````(````"0```` +MRH``F``````P`````````(````"`````D````,J``)@`````,`````````"` +M````@````)````#*@`"8`````#``````````@````(````"0````RH``F``` +M```P`````````(````"`````D````,J``)@`````,`````````"`````@``` +M`)````#*@`"8`````#``````````@````(````"0````RH``F``````P```` +M`````(````"`````D````,J``)@`````,`````````"`````@````)````#* +M@`"8`````#``````````@````(````"0````RH``F``````P`````````(`` +M``"`````D````,J``)@`````,`````````"`````@````)````#*@`"8```` +M`#``````````@````(````"0````RH``F``````P`````````(````"````` +MD````,J``)@`````,`````````"`````@````)````#*@`"8`````#`````` +M````@````(````"0````RH``F``````P`````````(````"`````D````,J` +M`)@`````,`````````"`````@````)````#*@`"8`````#``````````@``` +M`(````"0````RH``F``````P`````````(````"`````D````,J``)@````` +M,`````````"`````@````)````#*@`"8`````#``````````@````(````"0 +M````RH``F``````P`````````(````"`````D````,J``)@`````,``````` +M``"`````@````)````#*@`"8`````#``````````@````(````"0````RH`` +MF``````P`````````(````"`````D````,J``)@`````,`````````"````` +M@````)````#*@`"8`````#``````````@````(````"0````RH``F``````P +M`````````(````"`````D````,J``)@`````,`````````"`````@````)`` +M``#*@`"8`````#``````````@````(````"0````RH``F``````P```````` +M`(````"`````D````,J``)@`````,`````````"`````@````)````#*@`"8 +M`````#``````````@````(````"0````RH``F``````P`````````(````"` +M````D````,J``)@`````,`````````"`````@````)````#*@`"8`````#`` +M````````@````(````"0````RH``F``````P`````````(````"`````D``` +M`,J``)@`````,`````````"`````@````)````#*@`"8`````#`````````` +M@````(````"0````RH``F``````P`````````(````"`````D````,J``)@` +M````,`````````"`````@````)````#*@`"8`````#``````````@````(`` +M``"0````RH``F``````P`````````(````"`````D````,J``)@`````,``` +M``````"`````@````)````#*@`"8`````#``````````@````(````"0```` +MRH``F``````P`````````(````"`````D````,J``)@`````,`````````"` +M````@````)````#*@`"8`````#``````````@````(````"0````RH``F``` +M```P`````````(````"`````D````,J``)@`````,`````````"`````@``` +M`)````#*@`"8`````#``````````@````(````"0````RH``F``````P```` +M`````(````"`````D````,J``)@`````,`````````"`````@````)````#* +M@`"8`````#``````````@````(````"0````RH``F``````P`````````(`` +M``"`````D````,J``)@`````,`````````"`````@````)````#*@`"8```` +M`#``````````@````(````"0````RH``F``````P`````````(````"````` +MD````,J``)@`````,`````````"`````@````)````#*@`"8`````#`````` +M````@````(````"0````RH``F``````P`````````(````"`````D````,J` +M`)@`````,`````````"`````@````)````#*@`"8`````#``````````@``` +M`(````"0````RH``F``````P`````````(````"`````D````,J``)@````` +M,`````````"`````@````)````#*@`"8`````#``````````@````(````"0 +M````RH``F``````P`````````(````"`````D````,J``)@`````,``````` +M``"`````@````)````#*@`"8`````#``````````@````(````"0````RH`` +MF``````P`````````(````"`````D````,J``)@`````,`````````"````` +M@````)````#*@`"8`````#``````````@````(````"0````RH``F``````P +M`````````(````"`````D````,J``)@`````,`````````"`````@````)`` +M``#*@`"8`````#``````````@````(````"0````RH``F``````P```````` +M`(````"`````D````,J``)@`````,`````````"`````@````)````#*@`"8 +M`````#``````````@````(````"0````RH``F``````P`````````(````"` +M````D````,J``)@`````,`````````"`````@````)````#*@`"8`````#`` +M````````@````(````"0````RH``F``````P`````````(````"`````D``` +M`,J``)@`````,`````````"`````@````)````#*@`"8`````#`````````` +M@````(````"0````RH``F``````P`````````(````"`````D````,J``)@` +M````,`````````"`````@````)````#*@`"8`````#``````````@````(`` +M``"0````RH``F``````P`````````(````"`````D````,J``)@`````,``` +M``````"`````@````)````#*@`"8`````#``````````@````(````"0```` +MRH``F``````P`````````(````"`````D````,J``)@`````,`````````"` +M````@````)````#*@`"8`````#``````````@````(````"0````RH``F``` +M```P`````````(````"`````D````,J``)@`````,`````````"`````@``` +M`)````#*@`"8`````#``````````@````(````"0````RH``F``````P```` +M`````(````"`````D````,J``)@`````,`````````"`````@````)````#* +M@`"8`````#``````````@````(````"0````RH``F``````P`````````(`` +M``"`````D````,J``)@`````,`````````"`````@````)````#*@`"8```` +M`#``````````@````(````"0````RH``F``````P`````````(````"````` +MD````,J``)@`````,`````````"`````@````)````#*@`"8`````#`````` +M````@````(````"0````RH``F``````P`````````(````"`````D````,J` +M`)@`````,`````````"`````@````)````#*@`"8`````#``````````@``` +M`(````"0````RH``F``````P`````````(````"`````D````,J``)@````` +M,`````````"`````@````)````#*@`"8`````#``````````@````(````"0 +M````RH``F``````P`````````(````"`````D````,J``)@`````,``````` +M``"`````@````)````#*@`"8`````#``````````@````(````"0````RH`` +MF``````P`````````(````"`````D````,J``)@`````,`````````"````` +M@````)````#*@`"8`````#``````````@````(````"0````RH``F``````P +M`````````(````"`````D````,J``)@`````,`````````"`````@````)`` +M``#*@`"8`````#``````````@````(````"0````RH``F``````P```````` +M`(````"`````D````,J``)@`````,`````````"`````@````)````#*@`"8 +M`````#``````````@````(````"0````RH``F``````P`````````(````"` +M````D````,J``)@`````,`````````"`````@````)````#*@`"8`````#`` +M````````@````(````"0````RH``F``````P`````````(````"`````D``` +M`,J``)@`````,`````````"`````@````)````#*@`"8`````#`````````` +M@````(````"0````RH``F``````P`````````(````"`````D````,J``)@` +M````,`````````"`````@````)````#*@`"8`````#``````````@````(`` +M``"0````RH``F``````P`````````(````"`````D````,J``)@`````,``` +M``````"`````@````)````#*@`"8`````#``````````@````(````"0```` +MRH``F``````P`````````(````"`````D````,J``)@`````,`````````"` +M````@````)````#*@`"8`````#``````````@````(````"0````RH``F``` +M```P`````````(````"`````D````,J``)@`````,`````````"`````@``` +M`)````#*@`"8`````#``````````@````(````"0````RH``F``````P```` +M`````(````"`````D````,J``)@`````,`````````"`````@````)````#* +M@`"8`````#``````````@````(````"0````RH``F``````P`````````(`` +M``"`````D````,J``)@`````,`````````"`````@````)````#*@`"8```` +M`#``````````@````(````"0````RH``F``````P`````````(````"````` +MD````,J``)@`````,`````````"`````@````)````#*@`"8`````#`````` +M````@````(````"0````RH``F``````P`````````(````"`````D````,J` +M`)@`````,`````````"`````@````)````#*@`"8`````#``````````@``` +M`(````"0````RH``F``````P`````````(````"`````D````,J``)@````` +M,`````````"`````@````)````#*@`"8`````#``````````@````(````"0 +M````RH``F``````P`````````(````"`````D````,J``)@`````,``````` +M``"`````@````)````#*@`"8`````#``````````@````(````"0````RH`` +MF``````P`````````(````"`````D````,J``)@`````,`````````"````` +M@````)````#*@`"8`````#``````````@````(````"0````RH``F``````P +M`````````(````"`````D````,J``)@`````,`````````"`````@````)`` +M``#*@`"8`````#``````````@````(````"0````RH``F``````P```````` +M`(````"`````D````,J``)@`````,`````````"`````@````)````#*@`"8 +M`````#``````````@````(````"0````RH``F``````P`````````(````"` +M````D````,J``)@`````,`````````"`````@````)````#*@`"8`````#`` +M````````@````(````"0````RH``F``````P`````````(````"`````D``` +M`,J``)@`````,`````````"`````@````)````#*@`"8`````#`````````` +M@````(````"0````RH``F``````P`````````(````"`````D````,J``)@` +M````,`````````"`````@````)````#*@`"8`````#``````````@````(`` +M``"0````RH``F``````P`````````(````"`````D````,J``)@`````,``` +M``````"`````@````)````#*@`"8`````#``````````@````(````"0```` +MRH``F``````P`````````(````"`````D````,J``)@`````,`````````"` +M````@````)````#*@`"8`````#``````````@````(````"0````RH``F``` +M```P`````````(````"`````D````,J``)@`````,`````````"`````@``` +M`)````#*@`"8`````#``````````@````(````"0````RH``F``````P```` +M`````(````"`````D````,J``)@`````,`````````"`````@````)````#* +M@`"8`````#``````````@````(````"0````RH``F``````P`````````(`` +M``"`````D````,J``)@`````,`````````"`````@````-@``,"N@`"8```` +M`#``````````@````(````"0````RH``F``````P`````````(````"````` +MD````,J``)@`````,`````````"`````@````)````#*@`"8`````#`````` +M````@````(````"0````RH``F``````P`````````(````"`````D````,J` +M`)@`````,`````````"`````@````)````#*@`"8`````#``````````@``` +M`(````"0````RH``F``````P`````````(````"`````D````,J``)@````` +M,`````````"`````@````)````#*@`"8`````#``````````@````(````"0 +M````RH``F``````P`````````(````"`````D````,J``)@`````,``````` +M``"`````@````)````#*@`"8`````#``````````@````(````"0````RH`` +MF``````P`````````(````"`````D````,J````````'````%0```$4```!- +M````B0```"`!```8`@``5@(``)4"``#&`@``_0(``#\#``!]`P``O`,``/8# +M````!```.`0``&P$``":!```T@0``.H$```I!0``7@4``&\%``"J!0``Y`4` +M``L&```:!@``3@8``(D&``#(!@``!@<``#4'``!O!P``K@<``+H'``#>!P`` +M&P@``$`(``!>"```<0@``"H)```S"0``80D``)P)``#9"0``%0H``$X*``!W +M"@``BPH``)L*``#5"@``!`L``",+```V"P``5@L``&P+``"'"P``P`L``.P+ +M```I#```8PP``(H,``"?#```V0P``!D-```?#0``20T``'0-``"(#0``O0T` +M`.L-```'#@``-PX``$8.``!Z#@``B`X``+4.``#&#@``W`X```80```;$``` +MEA```,T0```*$0``*A$``%T1``"9$0``IQ$``+X1``#2$0``\!$```\2```Q +M$@``7A(``((2``"M$@``PQ(``/`2```6$P``+A,``(H3``"A$P``MA,``-H3 +M```(%```(Q0``$\4``""%```GQ0``,<4``#K%```&14``$H5``!R%0``E14` +M`+D5``#E%0``$A8``#D6``!A%@``B18``*\6``#0%@``[A8``!D7```Y%P`` +M61<``(T7``"U%P``W!<``/D7```?&```3A@``&@8``")&```JA@``,H8``#J +M&```#AD``#\9``!J&0``CAD``,`9``#?&0``_QD``"(:``!)&@``81H``(L: +M``"Q&@``SQH``.H:``!,*0``4"D``#@`D)EW,````-`````````&``````#_ +MOP$`@`$X`)"9=S````#0````````!@``````_[\!`(`!.@"0F7```:(P``BB<``&TK``!.+P``&P```!T````> +M````(````"$````C````)0```"8````H``````8``$XO```<``````````H! +M```0`0``WP,``.4#``#&!```R00``$`(``!="```7@@``&`(``!B"```<`@` +M`"P)```R"0``90D``'$)``#C"0``YPD``',*``!U"@``=PH``(8*``#5"@`` +MW0H``/4*``#]"@``;@L``'8+``!2#```6PP``*,,``"L#```"`X```P.``!' +M#@``30X``%X.``!D#@``H`X``*4.``"_#@``Q0X``-(1``#6$0``W1$``.(1 +M``#H$0``[Q$```<2```,$@``)A(``"L2``!($@``2A(``$T2``!2$@``7A(` +M`&02``"9$@``GA(``*T2``"S$@``\!(``/<2```6$P``&Q,``!P3```A$P`` +M-Q,``#T3```^$P``1!,``*83``"J$P``P!,``,D3``#:$P``X1,``/43```` +M%```"!0```X4```C%```+!0``$\4``!8%```@A0``(D4``#'%```SA0``#L5 +M``!!%0``0Q4``$D5``!+%0``414``)85``">%0``GQ4``*,5``"Z%0``OA4` +M`+\5``##%0``YA4``/$5``#R%0``]A4``!,6```;%@``'!8``"`6``!!%@`` +M118``&D6``!M%@``BA8``)$6``"P%@``N18``-$6``#8%@``&A<``!T7```Z +M%P``01<``'`7``!V%P``>!<``($7``"#%P``C!<``(X7``"6%P``MA<``,$7 +M``#=%P``XQ<``/H7```"&```(!@``"@8```I&```+1@``"X8```V&```3Q@` +M`%,8``!I&```<1@``(H8``"0&```RQ@``-(8``#K&```]!@```\9```3&0`` +M%!D``!@9```D&0``*AD``#89```^&0``0!D``$89``"/&0``EQD``,L9``#5 +M&0``UQD``-X9``#@&0``Z!D````:```*&@``(QH``"X:``!*&@``4!H``&(: +M``!J&@``:QH``&\:``"I&@``L!H``+(:``"Y&@``NAH``+X:``#0&@``UAH` +M`.L:``#T&@``#!L``!,;```I&P``,!L``$8;``!-&P``;!L``'(;``",&P`` +ME!L``'@=``!^'0```1X```0>```Y'@``/!X``$<>``!1'@``7QX``&0>``!R +M'@``=QX``,H>``#5'@``UAX``-@>``#:'@``Y!X```(?```*'P``)1\``"L? +M``!3'P``7!\``%T?``!C'P``9!\``&T?``"2'P``FQ\``)P?``"E'P``YA\` +M`.T?```2(```'2```$(@``!,(```;2```',@``"4(```G"```,8@``#-(``` +M22$``$XA``#?(0``Y2$``.8A``#P(0``\2$``/@A```7(@``(2(``$4B``!, +M(@``32(``%DB``!:(@``82(``*LB``"P(@``O2(``,$B``#-(@``TB(``-XB +M``#A(@``"2,``!`C``!I(P``<",``'(C``![(P``?",``'\C``"1(P``F",` +M`)HC``"C(P``QB,``,TC``#>(P``XB,``.,C``#J(P``!R0```LD```,)``` +M$R0``"R0``-4D``#;)```W"0``.`D``#U +M)```_"0``!0E```;)0``/"4``$HE``!M)0``="4``'8E``!_)0``D24``)LE +M``"<)0``I"4``*4E``"Q)0``R"4``,HE``#=)0``Y"4```(F```))@``"R8` +M`!,F```H)@``,"8``'@F``"')@``B28``)`F``"C)@``K28``+TF``##)@`` +MW"8``.0F``!")P``2"<``.@X``'P.``")#@``CPX``+4.``"[#@``V`X``-L.``!]#P`` +MA`\``&T0``!Y$```S1```-$0```*$0``%!$``%T1``!B$0``F1$``*`1``#2 +M$0``UA$``/`1``#W$0``#Q(``!02```Q$@``-A(``$@2``!*$@``31(``%(2 +M``!>$@``9!(``((2``"($@``F1(``)X2``"M$@``LQ(``,,2``#)$@``\!(` +M`/<2```6$P``&Q,``"X3```V$P``BA,``)(3``"A$P``I1,``+83``"_$P`` +MVA,``.$3```(%```#A0``",4```L%```3Q0``%@4``""%```B10``)\4``"D +M%```QQ0``,X4``!#%0``214``$L5``!1%0````!?'@``9!X``-H>``#D'@```A\```H?```E'P``*Q\` +M`%T?``!C'P``DA\``)L?``#1'P``TQ\``.8?``#M'P``$B```!T@``!"(``` +M3"```&T@``!S(```E"```)P@``#&(```S2```/,@``#[(```."$``#XA``!B +M(0``9R$``(HA``"3(0``MB$``+TA``#?(0``Y2$``.8A``#P(0``\2$``/@A +M```7(@``(2(``$4B``!,(@``FB(``)XB``"](@``P2(``-XB``#A(@``"2,` +M`!`C``!#(P``2",``&DC``!P(P``D2,``)@C``#&(P``S2,``.,C``#J(P`` +M#"0``!,D```G)```+20``&PD``!O)```CB0``) +M````#0```$1A=FED($UA`````@```#,`?4`>````%````$UI +M8W)O``$`"H`!@`%__W__`)H```#_@0```````%H`@`````,````` +M`$@```!(````$``0``,`!0```!`'2^"H!TOD)```````6@"```````!:`(`` +M```#@0````D```"#?_\`````"0```(-__P`````)````@W__`````'H"``!_ +M_W___@``!'__`````'__?__]```$?_]__P````!___L``.Y__Q9C&%[W:UI6 +MM6U[W5K5K6F,88QAK6F]VM:5K5K6EK6_FM:`F][9SEC&.5__P`````N!```?_]__P````#^?__\ +M```*?_\``'__``!__W__`````'__?_\``)I__P````#"`P``?_]__P``_G__ +M_@```'___0``"G__``!__W__``!__P````!__P````#N?_\48QAC&$I27O=C +M&'.<;WMO>UK67O=6M6UK6_FM:`6][6M;^:UH! +M;WM>]_YK6@%O>VM:_'__(F,88QAK6EK6:UI:UFM::UI:UG__:UI:UF][;WM: +MUFM:8QAK6F][;WM>]UK6:UIK6F,8;WMG.5K6;WMK6FM:;WMG.6V,8:UIO>VM::UI:UFM::UI6M7__9SGL?_\);WMC&&M:8QAK6F][ +M;WMK6FM:7O?^:UH44I1__V,87O=O>V,8:UIO>V][8QAC&%:U?_]O>UK69SE> +M]UK6:UIO>VM:^G__``````D```"#?_\`````I1<``'__?_]O>U:U?_]*4DYS +M=[UK6FM:1C%"$'.][L?_\";WMK6G.<_E[W +M!6]_UK6@-O>VM:4I1K6NQ__P5K6FM:7O=C&&,89SG^;WL9 +M8QAO>VM:9SESG%K66M9O>U[W;WM__VM:;WMWO6][7O=:UFVM:7O?C?_\@;WMC&&M:6M9>]UK6:UIO>VM::UI>]V,8 +M8QAG.7.<:UIO>VM:7O=K6EK6:UIC&&M:7O=O>V][:UIO>VM:V][5K5G.6M:9SE6M5*4:UIK6E[W2E)O>VM:]G__&U*45K5.]VU[W_FM: +M`%*4^'__'6M:]W.<4I1__V,88QAK6FM:7O=C&&,89SEO>V,86M9O>VM: +M4I1__UK68QAK6F][7O=G.6M::UIO>_9__P`````)````@W__`````&0```#5 +M?_\/:UISG%[W9SEG.6][4I1:UF][9SEO>V][7O=C&&M:7O?^;WL*8QA>]VM: +M;WMK6FM:9SEO>V,88QAO>_9__PI6M7>]6M92E&M:6M9O>V][6M96M6M:_E[W +MYG__``````D```"#?_\`````J0```/Y__P1"$%[W6M9O>V][W7__"5K69SE> +M]V,89SEO>UK68QAK6E:U_6M:%&][5K5G.6][;WM:UF][7O=O>U:U;WMG.6][ +M7O=>]VM:;WMO>VM::UISG/M__R-C&&,8:UI>]V][8QA:UFM:6M9C&'.<6M9K +M6EK68QAK6E[W;WM:UFM::UIC&&][9SE:UFM::UI:UE[W?_]C&&M:7O=K6EK6 +M:UK\?_\`````MP```/Y__PE>]V,87O=K6F_YK6A9>]U[W +M:UIO>U[W;WMG.6M:;WMO>V,81C%2E%[W6M9C&&][;WMK6F,89SEK6F]VM:6M9:UE[W9SGC?_\B:UIK6EK6:UI>]V,8;WM>]V]VM:;WMO>VM:7O=G.6,89SEC&&][7O=C&&M:7O=K6F][7O=G.5[W8QAO +M>W.<5K5:UOM__P`````)````@W__`````*$```#^?_\>7O=>]VM:;WMC&&M: +M;WMK6EK6:UI:UF][6M9K6E*4;WMG.6,8;WMO>U*46M9K6F]V][:UIC&&M:7O=O>V,8:UIK6E:U5K5G.7__:UISG&UK6:UIG.6][;WM:UE[W_F][`6,86M;^ +M:UH&;WMK6FM:9SEO>U[W6M;Q?_\B9SESG&M:8QAK6FM:8QA:UE[W:UI>]VM: +M7O=K6FM:;WM>]U:U=[UG.6]V][9SEK6F][8QAO>U[W6M9>]UK64I1: +MUE[W6M9G.5[W_FM:!5K6:UIO>VZ)__P````"Y````_G__'E[W:UI> +M]U:U9SE:UG__:UIK6E[W]V]VM:4I1C&&M:]W__`V,88QAK6F][_FM:&V][:UI2E&M:;WM>]W__5K5K +M6FV][7O=O>V][5K5K6FM:6M96M7.<^W__$&M: +M:UI>]V,88QAG.6,8;WM>]V]U[W;WM2E&M:;WOI?_\`````"0```(-_ +M_P````#3````_G__(&,86M9O>VM:8QAC&&][8QAO>W.<7O=O>U:U9SE:UFM: +M8QA:UFUK6:UIO>U[W;WMO>UK67O=K6OE__P]O>U:U:UIC +M&&M:;WM:UFM:8QAG.6,89SEC&%K6:UI>]_YK6@I2E'.<7O=K6FM:6M9K6G.< +M6M9K6F][_FM:`6][:UK[?_\)8QA2E&][:UIG.5[W4I1:UF,8:UK]7O<0:UIK +M6FVM:6M9C&/=__P````"4````U7__ +M''.<;WMK6G.<:UIK6E*4=[UK6G.<6M9O>VVM: +M:UIO>V,8;WMC&&,8;WO^:UKX?_\B;WMC&%[W:UI:UF][:UIK6F]V][8QA2E'__7O=K6EK6:UIO>V][:UI>]UK6?_]:UE*4?_]K6G__6M9K +M6OM__P````!/````_G__%U[W8QAO>V][5K5:UE[W6M9K6F][;WMC&%[W;WM> +M]VM:7O=2E&][:UIO>W__9SEG.?UK6@9O>V,8:UIK6F][6M9K6JE__P````"A +M````_G__(%[W9SEG.5[W8QAK6E[W;WMO>V]V][6M9K6OE__P!O>_YK6@IO>U:U?_]: +MUF][6M9K6DYS?_]K6F][_FM:`F][:UIC&/YK6@)O>UK67O?^:UH!7O=K6OA_ +M_PAO>VM:6M9:UE[W9SEK6F,8:UKA?_\`````"0```(-__P````"=````_G__ +M'UK67O=:UF,88QAG.6,8;WMO>UK68QAO>UK6:UIO>VM:4I1G.6,88QA>]U[W +M:UIO>VM:4I1G.7.<;WM:UFM:7O?X?_\":UIK6EK6_6,8#F]V][4I1S +MG%K6:UI6M6M::UIO>U*4?_]>]^Y__P]6M5:U=[U.]VM: +M:UIO>U[W9SEK6NA__P````!%````U7__#&M::UI>]V][:UI6M6M:9SEK6FM: +M9SEG.6M:Y7__#&,8;WMK6E:U:UIK6F]V][:UIK6F][Y7__`````!<` +M``#^?_\$8QAC&&XM__P````"9````_G__(V,8;WMO>V,87O=>]V][ +M8QAK6FM:5K5K6G.<4I1:UE[W3G-K6E[W:UIK6F,8;WMC&&][:UIC&&M::UIG +M.5[W9SEK6F,8;WMO>_Q__P)6M5:U2E+^5K4%9SEO>VW.<9SEK6E[W7O=K6FM:7O=G.6]U[WZW__``````D` +M``"#?_\`````OP```/Y__PM>]V][:UIO>VM::UIG.6][:UIK6DYS9SG^:UH% +M;WMO>VW.<]W__(U[W:UI>]V][:UIK +M6EK6;WMC&&][8QAO>VM::UI2E%:U3G-*4E[W:UIC&&][9SE:UF][9SEG.6,8 +M6M9K6F][4I1:UF][:UIG.?Q__P9:UG__:UIO>U[W4I1>]_YK6@I2E&,8:UIG +M.7>]9SEK6E[W7O=SG&]VM: +M;WMC&/-__Q1K6EK6:UI:UFM:;WM6M6][:UIK6EK65K5G.7>]9SEK6E[W7O=S +MG&UK6;WMC&%[W +M:UI>]VU:U:UIC&&][:UI>]U*45K5.V][]'__ +M$7.<:UI2E&M:6M9K6E*49SEO>V][:UISG&M:;WMG.5K69SEK6NI__P1O>VM: +M9SE>]V][_FM:$V][8QA>]V][:UIO>VM:;WM>]VM:;WMK6E:U:UIC&& +M]V]_YO>PI:UF,8:UIK6F,8;WMG.5K6;WM> +M]V]V][:UI>]VM:]VM:;WM:UFM:8QAO>V][5K5__U[W7O=C&.Q__P````"Q````_G__!V,8 +M4I1SG&,8;WMK6G.<7O?^:UH`;WO^7O<4;WMG.7__7O=C&&][:UIC&&M:9SE> +M]V][:UIG.6,87O=O>VV][_'__$G.<5K5K6FV][:UIK6F,8 +M;WMG.5K6;WMG.5*4:UIK6F][ZW__&&M:7O=:UF][:UI>]V,8;WMG.6][:UIO +M>W.<9SEK6E[W7O=SG%K6W>]\7__``````D```"#?_\````` +MAP```/Y__PEG.6M:7O=K6FM:;WMK6F,8:UI6M?YO>Q5:UDYS?_]K6E:U8QAO +M>VM:;WMO>V,85K5O>VM:9SE>]VM:7O=C&&][:UIO>_M__PMO>V][8QA:UFM: +MV,8:UI:UFM:7O?D?_\*6M9K6E*4?_]K6F][6M9K6F][8QAK6N-__P`` +M```)````@W__`````+,```#^?_\:;WMK6FM:7O=C&&M:8QAC&&][7O=O>V][ +M8QAO>U:U:UI>]W.<7O=O>VM::UIO>TYS9SEK6E[W_FM:!&]:UIG.5[W:UI2E&VM:UK6:UI: +MUFM::UIO>_-__P````##````_G__(6M::UIG.5[W:UI:UFM:7O=>]V][8QA> +M]VM:5K5K6F][6M9:UG__:UI2E%:U3G-K6E[W;WMC&&][4I1:UFM::UIG.6][ +M^G__'VVM:6M9K6F][;WMC&&][3G-K6EK68QAK6F][:UIC +M&&][9SE:UF][9SEG.6,8;WMC&&M:9SGX?_\#7O=K6FM:9SG^:UH.;WM:UF][ +M:UIK6F,8;WMO>VM:]V][[G__``````D```"#?_\`````;0`` +M`/Y__P5>]V][6M9K6EK6;WO>?_\.9SEK6FVU[W_FM:!U*4:UI:UG.<3G-__V][ +M:UKZ?_\':UIK6F,8:UI>]VM::UI6M?UK6@=6M6M:4I1K6E:UTI27O=C&%[W:UIG.5:U_'__`````$L```#^?_\%8QAC +M&$I25K5.UK6:UIO>VM:9SEC&&][6M9K6FM: +M7O=G.6M:9SEK6E*4:UJF?_\`````>0```/Y__QU:UFM::UIG.5*4:UIC&%K6 +M7O=SG&][:UIO>U*47O=>]V][:UIK6FVM:8QAK6E[W:UIO>V,8;WOV +M?_\#8QAK6FM:;WO]VM::UI>]VM::UI>]VM: +M;WOI?_\`````"0```(-__P````"@````_G__#EK6:UI*4G__;WM:UFM:;WMK +M6FW.<5K5G.?YK6@=>]V,8:UIO>V][8QA>]V][\G__('.<7O=K6EK6 +M;WM>]V,8:UI:UG__:UISG&M:;WM.]VM:7O=C&&M:6M9> +M]V,8VM:8QAK6OE___YK6@EC&&][4I1K6E[W8QA__V][8QAK6N5__P`` +M``!3````U7__%F][8QA>]V][6M9K6EK6;WM__V][4I1:UF][:UI:UF,8:UIK +M6F][8QA6M7.<;WOO?_\$:UI>]VM:8QAO>_YK6@):UG__7O?C?_\`````2P`` +M`/Y__P5C&&,82E)6M4YS5K7^7O<66M9G.7.<7O=O>V,8:UIG.6M:;WMK6EK6 +M6M9K6G.<6M9K6EK6:UI*4FZ9__P````!L````_G__#%K6:UIK6F]W.<;WMK6E[WY7__#&VM:Y7___FM:"E:U9SEG.6][:UIO>UK6:UI__UK6;WO^:UH"6M9K6F][['__ +M``````D```"#?_\`````U0```/Y__R-C&&][:UIG.6][:UI:UF][;WM:UE[W +M;WM:UF][6M9K6FM:9SEK6F][:UI:UFM:9SEK6E[W3G-SG&M:;WM>]U:U;WM_ +M_U[W:UK\?_\38QAC&&M:8QAK6EK66M9K6G.<:UI2E%:U3G-6M5[W4I1SG&M: +M;WM.<_YO>PQK6E:U6M9K6F_Q__Q!G.6,8:UI2 +ME'__7O=:UF][:UIO>U:U:UIK6G.<:UIK6E[W_FM:!5[W:UIK6E*4:UIO>_)_ +M_P````!U````U7__`F][7O=G.?YK6AM:UE:U]VM:;WM>]VM::UI>]VM:4I1>]V,8Z7__`````$<```#^?_\<:UI: +MUF,89SEC&&M:8QA:UFU:U5K5WO4(0 +M5K56M>1___YK6@!O>]Q__PMK6FM:8QA2E&M::UI:UFM:3G-K6FM:;WO^:UH) +M;WMK6F,8:UIK6F,8?_]K6E*4;WOQ?_\`````"0```(-__P````"_````_G__ +M(U*45K5.VM:3G-__VM:;WMO>U[W9SE>]VV][8QA>]V][ +M;WMK6E:U:UIC&&][8QAK6F]_Q__P5SG%*46M9>]W.<8QC^ +M;WL&:UI:UE*49SE__VM:6M;^:UH$6M9K6F][6M9K6O!__PAK6FM:8QA2E&M: +M:UI:UFM:3G/^:UH%V,8;WMK6E[W_FM:!U[W:UIK6E[W7O=C&&M:;WOU +M?_\`````J@```/Y__R)6M5K6?_]:UFM:7O=>]V][8QA>]VM:5K5K6G__4I12 +ME&][:U]>_V]_7O]O?VM?9S]O?VM?8Q]C'U:_3G]6OTY_5K]>_U[_^W__&&M: +M8QAO>VU[W;WMC&&M:?_]2E&][8QAG.6M:4I1G.6M:W.<7O=O +M>V][\7___FM:#%K65K5K6FM:4I1O>VM:;WM>]V,8;WMC&&M:Z'__``````D` +M``"#?_\`````BP```/Y__P)6M5:U2E+^5K437O=G.5[W6M9K6E[W8Q]>_W__ +M7O]__V<_9S]K7UK?8Q]K7U[_^)__Q=O>V][6M9>]VM::UI>]VM:6M9K6F][6M9K6G.<;WMG.6M:6M9O>U:U +M;WMO>VM:;WOP?_\`````"0```(-__P````"0````_G__!TYS4I1G.5K6;WM6 +MM5:U2E+^5K7C?_\1V,8:UIS +MG%K6_FM:"5K6:UI>]VM:;WM.U[W9SE>]VM: +M;WMK6F][9SE>]VW.<;WMK6EK6[G__`````+<```#^?_\> +M8QAK6E*45K5.VV,89SEK6E[W:UIK6E[W:UIC +M&&M:8QA6M7__6M9__UK6:UKW?_\-V][:UI:UFM: +M9SEK6OY>]P=:UF][?_]O>U[W9SEC&&M:\7__&5[W:UIK6EK6:UI:UF][;WMC +M&%K6:UIO>V,8:UIK6F]VM::UI:UFM:7O?R?_\`````"0`` +M`(-__P````!S````_G__(&][4I1:UF][:UI:UF,8:UI2E&][;WMC&&M:8QAO +M>V]VM:;WM:UF][6M9O>V][8QA:UFM:8QAK6OE__P]G.5*4 +M?_]K6E[W8QA:UG__:UI:UF][;WM6M6M:;WMC&+]__P`````)````@W__```` +M`(L```#^?_\B5K5>]U*43G-__V][6M9O>UK6:UIO>V]V][5K5SG&M: +M:UIO>U[W9SEK6E[W:UIO>VM:7O=:UFM:7O=G.7__8QAK6OM__QESG&M:5K5_ +M_V,8;WM.]VM::UI:UFM: +MR7__`````&D```#^?_\C6M9K6FM:;WM.U*46M9O>UK6:UIC&&M:;WMK6FM:9SEC&&][_'__ +M`&][_FM:!&][5K5__VM:;WNX?_\`````"0```(-__P````!_````_G__&5K6 +M:UI:UE[WV +M]V][7O?R?_\<VM:;WMK6F][7O=O>UK6:UIK6DI2 +M?_]>]V][8QAK6E[W8QAO>U[W;WMG.]V][ +M8QAK6K5__P````!1````_G__(6,8:UIC&%[W:UI2E%:U3G-6M5[W7O=K6F,8 +M;WMG.5K6VM:;WM2E%[W:UIK6FTI2J'__ +M`````(D```#^?_\B6M9:UG.<:UIG.5[W7O=SG&][5K5K6EK6:UI>]VM:8QA: +MUF][;WMC&&M:]W.<4I1O>V][8QAO>V][]U:U:UIC&/M__QASG$8Q +M?_]O>V,86M9K6F,8:UIK6E[W8QA:UF][6M9C&%:U?_]K6EK6:UIG.6][;WM: +MULA__P`````)````@W__`````#$```#^?_\&;WMK6FM:7O=.]P1__V][6M9K6F][N7__``````D```"#?_\`````"0```(-__P`` +M```)````@W__``````D```"#?_\`````"0```(-__P`````)````@W__```` +M``D```"#?_\`````"0```(-__P`````#@0````#_```````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M``````````````````````````#^_P```PH!```````````````````````! +M`````M7-U9PN&Q"3EP@`*RSYKC`````<`0``#`````$```!H````#P```'`` +M```%````J`````8```"P````$0```+@````7````P`````L```#(````$``` +M`-`````3````V````!8```#@````#0```.@````,````^P````(````0)P`` +M'@```#````!0;W-T+4=E;F]M:6-S(&%N9"!-;VQE8W5L87(@26YT97)A8W1I +M;VYS($-E;G1E<@`#````2`````,````1`````P```-DI```#````!`(+``L` +M````````"P`````````+``````````L`````````'A````$````'````14U" +M3U-3``P0```"````'@````8```!4:71L90`#`````0`````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M`````````````````````````````0````(````#````!`````4````&```` +M!P````@````)````"@````L````,````#0````X````/````$````!$````2 +M````$P```!0````5````%@```!<````8````&0```!H````;````'````!T` +M```>````'P```"`````A````(@```",````D````)0```"8````G````*``` +M`"D````J````*P```"P````M````+@```"\````P````,0```#(````S```` +M-````#4````V````-P```#@````Y````.@```/[___\\````/0```#X````_ +M````0````$$```!"````0P```$0```!%````1@```$<```!(````20```$H` +M``!+````3````$T```!.````3P```%````!1````4@```%,```!4````50`` +M`%8```!7````6````%D```!:````6P```%P```!=````7@```%\```!@```` +M_O___V(```!C````9````&4```!F````9P```&@```!I````:@```&L```!L +M````;0```&X```!O````<````'$```#^____0```/[____]____?````/[____^_____O________]2`&\`;P!T +M`"``10!N`'0`<@!Y```````````````````````````````````````````` +M````````````````%@`%`?__________`P````8)`@``````P````````$8` +M````````````````9VDYBPK(`7X```"``````````#$`5`!A`&(`;`!E```` +M```````````````````````````````````````````````````````````` +M```````.``(!_____P4```#_____```````````````````````````````` +M````````````````.P```-=+````````5P!O`'(`9`!$`&\`8P!U`&T`90!N +M`'0``````````````````````````````````````````````````````!H` +M`@$!````__________\````````````````````````````````````````` +M````````````DG4````````%`%,`=0!M`&T`80!R`'D`20!N`&8`;P!R`&T` +M80!T`&D`;P!N````````````````````````````````````*``"`0(````$ +M````_____P```````````````````````````````````````````````&$` +M``"D(`````````4`1`!O`&,`=0!M`&4`;@!T`%,`=0!M`&T`80!R`'D`20!N +M`&8`;P!R`&T`80!T`&D`;P!N```````````````X``(!________________ +M````````````````````````````````````````````````<@`````0```` +M`````0!#`&\`;0!P`$\`8@!J```````````````````````````````````` +M`````````````````````````````!(``@#_______________\````````` +M````````````````````````````````````````````6``````````````` +M```````````````````````````````````````````````````````````` +M`````````````````````````/_______________P`````````````````` +M```````````````````````````````````````````````````````````` +M```````````````````````````````````````````````````````````` +M````````````````________________```````````````````````````` +M`````````````````````````````````````0```/[_________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M____________________________________________________________ +M__________________________________________________________\! +M`/[_`@`!`/____\&"0(``````,````````!&&````$UI8W)OText, &thys->TextPtr); + + while(ok && +! (ajStrGetLen(qualstr) < seqlen) && +! (!ajStrPrefixC(seqReadLine, "@"))) + { + seqqualAppendWarn(&qualstr, seqReadLine); + +--- 2627,2634 ---- + seqin->Text, &thys->TextPtr); + + while(ok && +! ((ajStrGetLen(qualstr) < seqlen) || +! ajStrGetCharFirst(seqReadLine) != '@')) + { + seqqualAppendWarn(&qualstr, seqReadLine); + +*************** +*** 2790,2797 **** + seqin->Text, &thys->TextPtr); + + while(ok && +! (ajStrGetLen(qualstr) < seqlen) && +! (!ajStrPrefixC(seqReadLine, "@"))) + { + seqqualAppendWarn(&qualstr, seqReadLine); + +--- 2790,2797 ---- + seqin->Text, &thys->TextPtr); + + while(ok && +! ((ajStrGetLen(qualstr) < seqlen) || +! ajStrGetCharFirst(seqReadLine) != '@')) + { + seqqualAppendWarn(&qualstr, seqReadLine); + +*************** +*** 3157,3164 **** + seqin->Text, &thys->TextPtr); + + while(ok && +! (ajStrGetLen(qualstr) < seqlen) && +! (!ajStrPrefixC(seqReadLine, "@"))) + { + seqqualAppendWarn(&qualstr, seqReadLine); + +--- 3157,3164 ---- + seqin->Text, &thys->TextPtr); + + while(ok && +! ((ajStrGetLen(qualstr) < seqlen) || +! ajStrGetCharFirst(seqReadLine) != '@')) + { + seqqualAppendWarn(&qualstr, seqReadLine); + +*************** +*** 3352,3359 **** + seqin->Text, &thys->TextPtr); + + while(ok && +! (ajStrGetLen(qualstr) < seqlen) && +! (!ajStrPrefixC(seqReadLine, "@"))) + { + seqqualAppendWarn(&qualstr, seqReadLine); + +--- 3352,3359 ---- + seqin->Text, &thys->TextPtr); + + while(ok && +! ((ajStrGetLen(qualstr) < seqlen) || +! ajStrGetCharFirst(seqReadLine) != '@')) + { + seqqualAppendWarn(&qualstr, seqReadLine); + +*************** +*** 5254,5261 **** + return ajFalse; + } + +! ajStrAssignS(&thys->Name, seqReadLine); +! ajStrCutEnd(&thys->Name, 1); + bufflines++; + + while(ajBuffreadLineStore(buff, &seqReadLine, +--- 5254,5260 ---- + return ajFalse; + } + +! seqSetName(&thys->Name, seqReadLine); + bufflines++; + + while(ajBuffreadLineStore(buff, &seqReadLine, +*************** +*** 5330,5337 **** + return ajFalse; + } + +! ajStrAssignS(&thys->Name, seqReadLine); +! ajStrCutEnd(&thys->Name, 1); + bufflines++; + + while(ajBuffreadLineStore(buff, &seqReadLine, +--- 5329,5335 ---- + return ajFalse; + } + +! seqSetName(&thys->Name, seqReadLine); + bufflines++; + + while(ajBuffreadLineStore(buff, &seqReadLine, +*************** +*** 6651,6656 **** +--- 6649,6655 ---- + if(ajStrIsWhite(phyitem->Name) || + ajTableFetch(phytable, phyitem->Name)) + { ++ ajFilebuffSetBuffered(buff); + ajFilebuffResetStore(buff, seqin->Text, &thys->TextPtr); + ajDebug("phytable repeated name '%S'\n", + phyitem->Name); +*************** +*** 6745,6750 **** +--- 6744,6750 ---- + ajDebug("phylip format length mismatch at %d " + "(length %d)\n", + maxlen, ilen); ++ ajFilebuffSetBuffered(buff); + ajFilebuffResetStore(buff, + seqin->Text, &thys->TextPtr); + seqMsfDataDel((SeqPMsfData*) &seqin->Data); +*************** +*** 6771,6776 **** +--- 6771,6777 ---- + if(!done) + { + ajDebug("seqReadPhylip read failed, try seqReadPhylipnon\n"); ++ ajFilebuffSetBuffered(buff); + ajFilebuffResetStore(buff, seqin->Text, &thys->TextPtr); + seqMsfDataDel((SeqPMsfData*) &seqin->Data); + +*************** +*** 6781,6786 **** +--- 6782,6788 ---- + { + ajDebug("Phylip format %d sequences partly read at end\n", + iseq-jseq); ++ ajFilebuffSetBuffered(buff); + ajFilebuffResetStore(buff, seqin->Text, &thys->TextPtr); + seqMsfDataDel((SeqPMsfData*) &seqin->Data); + +*************** +*** 10973,10978 **** +--- 10975,10982 ---- + if(!ajBuffreadLine(buff, &seqReadLine)) + return ajFalse; + ++ ajDebug("++seqReadGenbank first line '%S'\n", seqReadLine); ++ + bufflines++; + + ok = ajTrue; +*************** +*** 11030,11035 **** +--- 11034,11040 ---- + + if(nfields == 9) + { ++ ajFilebuffSetBuffered(buff); + ajFilebuffResetStore(buff, seqin->Text, &thys->TextPtr); + + return seqReadGenpept(thys,seqin); +*************** +*** 11053,11062 **** +--- 11058,11070 ---- + case 4: + if(ajStrMatchC(token, "aa")) + { ++ ajFilebuffSetBuffered(buff); + ajFilebuffResetStore(buff, seqin->Text, &thys->TextPtr); + ajStrDel(&token); + ajStrTokenDel(&handle); + ++ ajDebug("first line %d aa pass to refseqp '%S'\n", ++ buff->Pos, seqReadLine); + return seqReadRefseqp(thys,seqin); + } + if(!ajStrMatchC(token, "bp")) +*************** +*** 11521,11526 **** +--- 11529,11535 ---- + + if(nfields == 8) + { ++ ajFilebuffSetBuffered(buff); + ajFilebuffResetStore(buff, seqin->Text, &thys->TextPtr); + + return seqReadRefseqp(thys,seqin); +*************** +*** 11916,11921 **** +--- 11925,11932 ---- + if(!ajBuffreadLine(buff, &seqReadLine)) + return ajFalse; + ++ ajDebug("++seqReadRefseqp %d first line '%S'\n", buff->Pos, seqReadLine); ++ + bufflines++; + + ok = ajTrue; +*************** +*** 12303,12310 **** + ok = ajBuffreadLineStore(buff,&seqReadLine, + seqin->Text, &thys->TextPtr); + +- + ajFilebuffClear(buff, 0); + + ajStrTokenDel(&handle); + ajStrDel(&token); +--- 12314,12321 ---- + ok = ajBuffreadLineStore(buff,&seqReadLine, + seqin->Text, &thys->TextPtr); + + ajFilebuffClear(buff, 0); ++ ajDebug("++last line %d '%S'\n", buff->Pos, seqReadLine); + + ajStrTokenDel(&handle); + ajStrDel(&token); +diff -c -N --recursive EMBOSS-6.1.0orig/ajax/ajseqwrite.c EMBOSS-6.1.0/ajax/ajseqwrite.c +*** EMBOSS-6.1.0orig/ajax/ajseqwrite.c 2009-07-06 16:50:31.000000000 +0100 +--- EMBOSS-6.1.0/ajax/ajseqwrite.c 2009-07-30 15:27:55.000000000 +0100 +*************** +*** 231,237 **** + AJFALSE, AJFALSE, AJFALSE, AJTRUE, AJTRUE, + AJFALSE, AJTRUE, AJFALSE, seqWriteGcg}, + {"gcg8", "GCG old (version 8) sequence format", +! AJFALSE, AJFALSE, AJFALSE, AJTRUE, AJTRUE, + AJFALSE, AJTRUE, AJFALSE, seqWriteGcg}, /* alias for gcg */ + {"embl", "EMBL entry format", + AJFALSE, AJFALSE, AJFALSE, AJTRUE, AJFALSE, +--- 231,237 ---- + AJFALSE, AJFALSE, AJFALSE, AJTRUE, AJTRUE, + AJFALSE, AJTRUE, AJFALSE, seqWriteGcg}, + {"gcg8", "GCG old (version 8) sequence format", +! AJTRUE, AJFALSE, AJFALSE, AJTRUE, AJTRUE, + AJFALSE, AJTRUE, AJFALSE, seqWriteGcg}, /* alias for gcg */ + {"embl", "EMBL entry format", + AJFALSE, AJFALSE, AJFALSE, AJTRUE, AJFALSE, +*************** +*** 240,246 **** + AJTRUE, AJFALSE, AJFALSE, AJTRUE, AJFALSE, + AJTRUE, AJTRUE, AJFALSE, seqWriteEmbl}, + {"emblold", "EMBL entry format (alias)", +! AJFALSE, AJFALSE, AJFALSE, AJTRUE, AJFALSE, + AJTRUE, AJTRUE, AJFALSE, seqWriteEmbl}, /* embl pre-87 format*/ + {"em", "EMBL entry format (alias)", + AJTRUE, AJFALSE, AJFALSE, AJTRUE, AJFALSE, +--- 240,246 ---- + AJTRUE, AJFALSE, AJFALSE, AJTRUE, AJFALSE, + AJTRUE, AJTRUE, AJFALSE, seqWriteEmbl}, + {"emblold", "EMBL entry format (alias)", +! AJTRUE, AJFALSE, AJFALSE, AJTRUE, AJFALSE, + AJTRUE, AJTRUE, AJFALSE, seqWriteEmbl}, /* embl pre-87 format*/ + {"em", "EMBL entry format (alias)", + AJTRUE, AJFALSE, AJFALSE, AJTRUE, AJFALSE, +*************** +*** 255,261 **** + AJTRUE, AJFALSE, AJFALSE, AJFALSE, AJTRUE, + AJTRUE, AJTRUE, AJFALSE, seqWriteSwiss}, + {"swissold", "Swissprot entry format", /* format before 2006 release */ +! AJFALSE, AJFALSE, AJFALSE, AJFALSE, AJTRUE, + AJTRUE, AJTRUE, AJFALSE, seqWriteSwiss}, + {"swissprotold","Swissprot entry format", + AJTRUE, AJFALSE, AJFALSE, AJFALSE, AJTRUE, +--- 255,261 ---- + AJTRUE, AJFALSE, AJFALSE, AJFALSE, AJTRUE, + AJTRUE, AJTRUE, AJFALSE, seqWriteSwiss}, + {"swissold", "Swissprot entry format", /* format before 2006 release */ +! AJTRUE, AJFALSE, AJFALSE, AJFALSE, AJTRUE, + AJTRUE, AJTRUE, AJFALSE, seqWriteSwiss}, + {"swissprotold","Swissprot entry format", + AJTRUE, AJFALSE, AJFALSE, AJFALSE, AJTRUE, +*************** +*** 347,353 **** + {"msf", "GCG MSF (mutiple sequence file) file format", + AJFALSE, AJFALSE, AJTRUE, AJTRUE, AJTRUE, + AJFALSE, AJTRUE, AJFALSE, seqWriteMsf}, +! {"clustal", "Clustalw output format", + AJFALSE, AJFALSE, AJTRUE, AJTRUE, AJTRUE, + AJFALSE, AJTRUE, AJFALSE, seqWriteClustal}, + {"aln", "Clustalw output format (alias)", +--- 347,353 ---- + {"msf", "GCG MSF (mutiple sequence file) file format", + AJFALSE, AJFALSE, AJTRUE, AJTRUE, AJTRUE, + AJFALSE, AJTRUE, AJFALSE, seqWriteMsf}, +! {"clustal", "Clustalw multiple alignment format", + AJFALSE, AJFALSE, AJTRUE, AJTRUE, AJTRUE, + AJFALSE, AJTRUE, AJFALSE, seqWriteClustal}, + {"aln", "Clustalw output format (alias)", +*************** +*** 1360,1374 **** + + static void seqWriteFastqSanger(AjPSeqout outseq) + { +- ajuint i; + ajuint j; + ajuint ilen; +- ajuint jlen; + AjPStr seq = NULL; +- ajuint linelen = 60; +- ajuint iend; + AjPStr db = NULL; +! char qchar; + + ajStrAssignS(&db, outseq->Setoutdb); + /* ajStrAssignEmptyS(&db, outseq->Db);*/ +--- 1360,1370 ---- + + static void seqWriteFastqSanger(AjPSeqout outseq) + { + ajuint j; + ajuint ilen; + AjPStr seq = NULL; + AjPStr db = NULL; +! ajint qchar; + + ajStrAssignS(&db, outseq->Setoutdb); + /* ajStrAssignEmptyS(&db, outseq->Db);*/ +*************** +*** 1394,1430 **** + ajFmtPrintF(outseq->File, "\n"); + ilen = ajStrGetLen(outseq->Seq); + +! for(i=0; i < ilen; i += linelen) +! { +! iend = AJMIN(ilen-1, i+linelen-1); +! ajStrAssignSubS(&seq, outseq->Seq, i, iend); +! ajFmtPrintF(outseq->File, "%S\n", seq); +! } +! +! ajFmtPrintF(outseq->File, "+%S", outseq->Name); +! +! if(ajStrGetLen(outseq->Sv)) +! ajFmtPrintF(outseq->File, " %S", outseq->Sv); +! else if(ajStrGetLen(outseq->Acc)) +! ajFmtPrintF(outseq->File, " %S", outseq->Acc); + +! ajFmtPrintF(outseq->File, "\n"); + + ilen = ajStrGetLen(outseq->Seq); + + if(outseq->Accuracy) + { +! for(i=0; i < ilen; i += linelen) + { +! iend = AJMIN(ilen-1, i+linelen-1); +! ajStrAssignClear(&seq); +! for(j=i;j<=iend;j++) +! { +! qchar = 33 + (int) outseq->Accuracy[j]; +! ajStrAppendK(&seq, qchar); +! } +! ajFmtPrintF(outseq->File, "%S\n", seq); + } + } + + else +--- 1390,1416 ---- + ajFmtPrintF(outseq->File, "\n"); + ilen = ajStrGetLen(outseq->Seq); + +! ajFmtPrintF(outseq->File, "%S\n", outseq->Seq); + +! ajFmtPrintF(outseq->File, "+\n"); + + ilen = ajStrGetLen(outseq->Seq); + + if(outseq->Accuracy) + { +! ajStrAssignClear(&seq); +! +! for(j=0;jAccuracy[j]); +! if(qchar > 126) +! qchar = 126; +! if(qchar < 33) +! qchar = 33; +! ajStrAppendK(&seq, (char) qchar); + } ++ ++ ajFmtPrintF(outseq->File, "%S\n", seq); + } + + else +*************** +*** 1433,1447 **** + ** default to a score of 1 (0.75 error : 1 base in 4 is right) + */ + +! for(i=0; i < ilen; i += linelen) +! { +! iend = AJMIN(ilen-1, i+linelen-1); +! jlen = (iend - i + 1); +! ajStrAssignClear(&seq); +! ajStrAppendCountK(&seq,'\"', jlen); +! ajFmtPrintF(outseq->File, "%S\n", seq); +! } + + } + + ajStrDel(&seq); +--- 1419,1429 ---- + ** default to a score of 1 (0.75 error : 1 base in 4 is right) + */ + +! ajStrAssignClear(&seq); +! +! ajStrAppendCountK(&seq,'\"', ilen); + ++ ajFmtPrintF(outseq->File, "%S\n", seq); + } + + ajStrDel(&seq); +*************** +*** 1464,1478 **** + + static void seqWriteFastqIllumina(AjPSeqout outseq) + { +- ajuint i; + ajuint j; + ajuint ilen; +- ajuint jlen; + AjPStr seq = NULL; +- ajuint linelen = 60; +- ajuint iend; + AjPStr db = NULL; +! char qchar; + + ajStrAssignS(&db, outseq->Setoutdb); + /* ajStrAssignEmptyS(&db, outseq->Db);*/ +--- 1446,1456 ---- + + static void seqWriteFastqIllumina(AjPSeqout outseq) + { + ajuint j; + ajuint ilen; + AjPStr seq = NULL; + AjPStr db = NULL; +! ajint qchar; + + ajStrAssignS(&db, outseq->Setoutdb); + /* ajStrAssignEmptyS(&db, outseq->Db);*/ +*************** +*** 1498,1534 **** + ajFmtPrintF(outseq->File, "\n"); + ilen = ajStrGetLen(outseq->Seq); + +! for(i=0; i < ilen; i += linelen) +! { +! iend = AJMIN(ilen-1, i+linelen-1); +! ajStrAssignSubS(&seq, outseq->Seq, i, iend); +! ajFmtPrintF(outseq->File, "%S\n", seq); +! } +! +! ajFmtPrintF(outseq->File, "+%S", outseq->Name); +! +! if(ajStrGetLen(outseq->Sv)) +! ajFmtPrintF(outseq->File, " %S", outseq->Sv); +! else if(ajStrGetLen(outseq->Acc)) +! ajFmtPrintF(outseq->File, " %S", outseq->Acc); +! +! ajFmtPrintF(outseq->File, "\n"); + + ilen = ajStrGetLen(outseq->Seq); + + if(outseq->Accuracy) + { +! for(i=0; i < ilen; i += linelen) + { +! iend = AJMIN(ilen-1, i+linelen-1); +! ajStrAssignClear(&seq); +! for(j=i;j<=iend;j++) +! { +! qchar = 64 + (int) outseq->Accuracy[j]; +! ajStrAppendK(&seq, qchar); +! } +! ajFmtPrintF(outseq->File, "%S\n", seq); + } + } + + else +--- 1476,1501 ---- + ajFmtPrintF(outseq->File, "\n"); + ilen = ajStrGetLen(outseq->Seq); + +! ajFmtPrintF(outseq->File, "%S\n", outseq->Seq); +! ajFmtPrintF(outseq->File, "+\n"); + + ilen = ajStrGetLen(outseq->Seq); + + if(outseq->Accuracy) + { +! ajStrAssignClear(&seq); +! +! for(j=0;jAccuracy[j]); +! if(qchar > 126) +! qchar = 126; +! else if(qchar < 33) +! qchar = 33; +! ajStrAppendK(&seq, (char) qchar); + } ++ ++ ajFmtPrintF(outseq->File, "%S\n", seq); + } + + else +*************** +*** 1537,1551 **** + ** default to a score of 1 (0.75 error : 1 base in 4 is right) + */ + +! for(i=0; i < ilen; i += linelen) +! { +! iend = AJMIN(ilen-1, i+linelen-1); +! jlen = (iend - i + 1); +! ajStrAssignClear(&seq); +! ajStrAppendCountK(&seq,'A', jlen); +! ajFmtPrintF(outseq->File, "%S\n", seq); +! } + + } + + ajStrDel(&seq); +--- 1504,1514 ---- + ** default to a score of 1 (0.75 error : 1 base in 4 is right) + */ + +! ajStrAssignClear(&seq); +! +! ajStrAppendCountK(&seq,'A', ilen); + ++ ajFmtPrintF(outseq->File, "%S\n", seq); + } + + ajStrDel(&seq); +*************** +*** 1568,1582 **** + + static void seqWriteFastqSolexa(AjPSeqout outseq) + { +- ajuint i; + ajuint j; + ajuint ilen; +- ajuint jlen; + AjPStr seq = NULL; +- ajuint linelen = 60; +- ajuint iend; + AjPStr db = NULL; +! char qchar; + double sval; + double pval; + double qval; +--- 1531,1541 ---- + + static void seqWriteFastqSolexa(AjPSeqout outseq) + { + ajuint j; + ajuint ilen; + AjPStr seq = NULL; + AjPStr db = NULL; +! ajint qchar; + double sval; + double pval; + double qval; +*************** +*** 1605,1651 **** + ajFmtPrintF(outseq->File, "\n"); + ilen = ajStrGetLen(outseq->Seq); + +! for(i=0; i < ilen; i += linelen) +! { +! iend = AJMIN(ilen-1, i+linelen-1); +! ajStrAssignSubS(&seq, outseq->Seq, i, iend); +! ajFmtPrintF(outseq->File, "%S\n", seq); +! } + +! ajFmtPrintF(outseq->File, "+%S", outseq->Name); +! +! if(ajStrGetLen(outseq->Sv)) +! ajFmtPrintF(outseq->File, " %S", outseq->Sv); +! else if(ajStrGetLen(outseq->Acc)) +! ajFmtPrintF(outseq->File, " %S", outseq->Acc); +! +! ajFmtPrintF(outseq->File, "\n"); + + ilen = ajStrGetLen(outseq->Seq); + + if(outseq->Accuracy) + { +! for(i=0; i < ilen; i += linelen) + { +! iend = AJMIN(ilen-1, i+linelen-1); +! ajStrAssignClear(&seq); +! for(j=i;j<=iend;j++) +! { +! sval = outseq->Accuracy[j]; +! pval = 1.0 / pow(10.0, (sval/10.0)); + +! /*adjust zero phred score to 0.75 error rate */ +! if(pval == 1.0) +! pval = 0.75; +! +! qval = 0.5 + -10.0 * log10(pval/(1.0 - pval)); +! qchar = 64 + (int) qval; +! ajStrAppendK(&seq, qchar); +! ajDebug("[%d] aval:%.4f qval:%.4f %d '%c'\n", +! j, sval, qval, (int)qval, qchar); +! } +! ajFmtPrintF(outseq->File, "%S\n", seq); + } + } + + else +--- 1564,1602 ---- + ajFmtPrintF(outseq->File, "\n"); + ilen = ajStrGetLen(outseq->Seq); + +! ajFmtPrintF(outseq->File, "%S\n", outseq->Seq); + +! ajFmtPrintF(outseq->File, "+\n"); + + ilen = ajStrGetLen(outseq->Seq); + + if(outseq->Accuracy) + { +! ajStrAssignClear(&seq); +! +! for(j=0;jAccuracy[j]; +! pval = 1.0 / pow(10.0, (sval/10.0)); + +! /*adjust zero phred score to 0.75 error rate */ +! if(pval > 0.75) +! pval = 0.75; +! +! qval = -10.0 * log10(pval/(1.0 - pval)); +! if(qval >= 0.0) +! qchar = 64 + (int) (qval + 0.5); +! else +! qchar = 64 + (int) (qval - 0.5); +! if(qchar > 126) +! qchar = 126; +! else if(qchar < 33) +! qchar = 33; +! ajStrAppendK(&seq, (char) qchar); +! ajDebug("[%d] aval:%.4f qval:%.4f %d '%c'\n", +! j, sval, qval, (int)qval, qchar); + } ++ ajFmtPrintF(outseq->File, "%S\n", seq); + } + + else +*************** +*** 1654,1668 **** + ** default to a score of -5 (0.75 error : 1 base in 4 is right) + */ + +! for(i=0; i < ilen; i += linelen) +! { +! iend = AJMIN(ilen-1, i+linelen-1); +! jlen = (iend - i + 1); +! ajStrAssignClear(&seq); +! ajStrAppendCountK(&seq,';', jlen); +! ajFmtPrintF(outseq->File, "%S\n", seq); +! } + + } + + ajStrDel(&seq); +--- 1605,1615 ---- + ** default to a score of -5 (0.75 error : 1 base in 4 is right) + */ + +! ajStrAssignClear(&seq); +! +! ajStrAppendCountK(&seq,';', ilen); + ++ ajFmtPrintF(outseq->File, "%S\n", seq); + } + + ajStrDel(&seq); +*************** +*** 7798,7803 **** +--- 7745,7751 ---- + + + ++ + /* @funcstatic seqSeqFormat *************************************************** + ** + ** Initialises sequence output formatting parameters. +diff -c -N --recursive EMBOSS-6.1.0orig/ajax/ajstr.c EMBOSS-6.1.0/ajax/ajstr.c +*** EMBOSS-6.1.0orig/ajax/ajstr.c 2009-06-22 16:51:03.000000000 +0100 +--- EMBOSS-6.1.0/ajax/ajstr.c 2009-08-25 09:30:30.000000000 +0100 +*************** +*** 3,13 **** + ** + ** AjPStr objects are reference counted strings + ** Any change will need a new string object if the use count +! ** is greater than 1, so the original ajStr provided so that it can +! ** be reallocated in any routine where string modification is possible. + ** +! ** In many cases +! ** the text is always a copy, even of a constant original, so + ** that it can be simply freed. + ** + ** @author Copyright (C) 1998 Peter Rice +--- 3,13 ---- + ** + ** AjPStr objects are reference counted strings + ** Any change will need a new string object if the use count +! ** is greater than 1, so the original AjPStr is provided as a pointer +! ** so that it can be reallocated in any routine where string modification +! ** may be needed. + ** +! ** In many cases the text is always a copy, even of a constant original, so + ** that it can be simply freed. + ** + ** @author Copyright (C) 1998 Peter Rice +*************** +*** 2042,2047 **** +--- 2042,2048 ---- + ** @nam4rule NewRes Construct with reserved size. + ** + ** @argrule C txt [const char*] Text string ++ ** @argrule K ch [char] Single character + ** @argrule S str [const AjPStr] Text string + ** @argrule NewRes size [ajuint] Reserved size + ** @argrule NewRef refstr [AjPStr] Text string to be duplicated +*************** +*** 2099,2104 **** +--- 2100,2132 ---- + + + ++ /* @func ajStrNewK ************************************************************ ++ ** ++ ** String constructor which allocates memory for a string and initialises it ++ ** with the single character provided. ++ ** ++ ** The string size is set just large enough to hold the supplied text. ++ ** ++ ** @param [r] ch [char] Null-terminated character string to initialise ++ ** the new string. ++ ** @return [AjPStr] Pointer to a string containing the supplied text ++ ** @@ ++ ******************************************************************************/ ++ ++ AjPStr ajStrNewK(char ch) ++ { ++ char txt[2] = " "; ++ AjPStr thys; ++ ++ txt[0] = ch; ++ thys = ajStrNewResLenC(txt, 2, 1); ++ ++ return thys; ++ } ++ ++ ++ ++ + /* @func ajStrNewS ************************************************************ + ** + ** String constructor which allocates memory for a string and initialises it +*************** +*** 6106,6111 **** +--- 6134,6157 ---- + + + ++ /* @func ajStrTrimWhiteStart ************************************************** ++ ** ++ ** Removes regions composed of white space characters only from the start of a ++ ** string. ++ ** ++ ** @param [u] Pstr [AjPStr*] String ++ ** @return [AjBool] ajTrue if string was reallocated ++ ** @@ ++ ******************************************************************************/ ++ ++ AjBool ajStrTrimWhiteStart(AjPStr* Pstr) ++ { ++ return ajStrTrimStartC(Pstr, "\t \n\r"); ++ } ++ ++ ++ ++ + /* @func ajStrTruncateLen ***************************************************** + ** + ** Removes the end from a string reducing it to a defined length. +*************** +*** 8512,8524 **** + + thys = *Pstr; + +! if((thys->Use > 1) || (thys->Res < savesize)) + { + strCloneL(Pstr, savesize); + + return ajTrue; + } + + return ajFalse; + } + +--- 8558,8578 ---- + + thys = *Pstr; + +! if(thys->Use > 1) + { + strCloneL(Pstr, savesize); + + return ajTrue; + } + ++ if(thys->Res < savesize) ++ { ++ AJRESIZE(thys->Ptr, savesize); ++ thys->Res = savesize; ++ ++ return ajTrue; ++ } ++ + return ajFalse; + } + +*************** +*** 8565,8570 **** +--- 8619,8631 ---- + + thys = *Pstr; + ++ if(thys->Use > 1) ++ { ++ strCloneL(Pstr, size); ++ ++ return ajTrue; ++ } ++ + if(thys->Res < size) + { + if(size >= LONGSTR) +*************** +*** 8579,8592 **** + else + roundsize = ajRound(size, STRSIZE); + +! strCloneL(Pstr, roundsize); +! +! return ajTrue; +! } +! +! if(thys->Use > 1) +! { +! strCloneL(Pstr, size); + + return ajTrue; + } +--- 8640,8647 ---- + else + roundsize = ajRound(size, STRSIZE); + +! AJRESIZE(thys->Ptr, roundsize); +! thys->Res = roundsize; + + return ajTrue; + } +diff -c -N --recursive EMBOSS-6.1.0orig/ajax/ajstr.h EMBOSS-6.1.0/ajax/ajstr.h +*** EMBOSS-6.1.0orig/ajax/ajstr.h 2009-06-22 16:51:04.000000000 +0100 +--- EMBOSS-6.1.0/ajax/ajstr.h 2009-08-25 09:30:34.000000000 +0100 +*************** +*** 65,70 **** +--- 65,73 ---- + ** + ** String iterator, used to test iterator functionality. + ** ++ ** @alias AjSStrIter ++ ** @alias AjOStrIter ++ ** + ** @new ajStrIter Creates and initializes an iterator for a string + ** + ** @delete ajStrIterFree Destructor for a string iterator +*************** +*** 192,197 **** +--- 195,201 ---- + + AjPStr ajStrNew (void); + AjPStr ajStrNewC (const char *txt); ++ AjPStr ajStrNewK (char ch); + AjPStr ajStrNewS (const AjPStr str); + AjPStr ajStrNewRef(AjPStr str); + AjPStr ajStrNewRes(ajuint size); +*************** +*** 296,301 **** +--- 300,306 ---- + AjBool ajStrTrimStartC (AjPStr* Pstr, const char* txt); + AjBool ajStrTrimWhite(AjPStr* Pstr); + AjBool ajStrTrimWhiteEnd(AjPStr* Pstr); ++ AjBool ajStrTrimWhiteStart(AjPStr* Pstr); + AjBool ajStrTruncateLen(AjPStr* Pstr, ajuint len); + AjBool ajStrTruncatePos(AjPStr* Pstr, ajint pos); + +diff -c -N --recursive EMBOSS-6.1.0orig/jemboss/org/emboss/jemboss/gui/Browser.java EMBOSS-6.1.0/jemboss/org/emboss/jemboss/gui/Browser.java +*** EMBOSS-6.1.0orig/jemboss/org/emboss/jemboss/gui/Browser.java 2009-06-30 17:18:26.000000000 +0100 +--- EMBOSS-6.1.0/jemboss/org/emboss/jemboss/gui/Browser.java 2009-07-30 15:29:18.000000000 +0100 +*************** +*** 68,74 **** +--- 68,77 ---- + import javax.swing.tree.DefaultMutableTreeNode; + import javax.swing.tree.TreeSelectionModel; + ++ import org.emboss.jemboss.Jemboss; + import org.emboss.jemboss.JembossParams; ++ import org.emboss.jemboss.server.JembossServer; ++ import org.emboss.jemboss.soap.GetVersion; + + + /** +*************** +*** 110,115 **** +--- 113,120 ---- + private JMenuItem fwdMenu; + /** Forward button option */ + private JButton fwdBt; ++ /** version of EMBOSS programs */ ++ String embossVersion = "6.1"; + + /** + * +*************** +*** 178,185 **** + URL pageURL = new URL(initialURL); + setURL(pageURL,initialURL); + } + } +! + + /** + * +--- 183,193 ---- + URL pageURL = new URL(initialURL); + setURL(pageURL,initialURL); + } ++ if (Jemboss.withSoap){ ++ embossVersion = GetVersion.getVersion(mysettings); ++ } + } +! + + /** + * +*************** +*** 712,719 **** + loc = "http://emboss.sourceforge.net/Jemboss/"; + else if(selectedValue.equals("Home") && category.equals("EMBOSS")) + loc = "http://emboss.sourceforge.net/"; +! else if(selectedValue.equals("Apps") && category.equals("EMBOSS")) +! loc = "http://emboss.sourceforge.net/apps/release/6.0/emboss/apps/"; + + if(loc != null) + { +--- 720,732 ---- + loc = "http://emboss.sourceforge.net/Jemboss/"; + else if(selectedValue.equals("Home") && category.equals("EMBOSS")) + loc = "http://emboss.sourceforge.net/"; +! else if(selectedValue.equals("Apps") && category.equals("EMBOSS")){ +! if (!JembossParams.isJembossServer()){ +! embossVersion = new JembossServer().version(); +! embossVersion = embossVersion.split("\\.")[0]+"."+embossVersion.split("\\.")[1]; +! } +! loc = "http://emboss.sourceforge.net/apps/release/"+embossVersion+"/emboss/apps/"; +! } + + if(loc != null) + { +diff -c -N --recursive EMBOSS-6.1.0orig/jemboss/org/emboss/jemboss/gui/BuildProgramMenu.java EMBOSS-6.1.0/jemboss/org/emboss/jemboss/gui/BuildProgramMenu.java +*** EMBOSS-6.1.0orig/jemboss/org/emboss/jemboss/gui/BuildProgramMenu.java 2009-07-08 09:45:48.000000000 +0100 +--- EMBOSS-6.1.0/jemboss/org/emboss/jemboss/gui/BuildProgramMenu.java 2009-07-30 15:29:31.000000000 +0100 +*************** +*** 141,146 **** +--- 141,162 ---- + return woss; + } + ++ private synchronized void updateConnectionSettings(){ ++ splashing.doneSomething("Cannot connect!"); ++ ServerSetup ss = new ServerSetup(mysettings); ++ splashThread.setInterval(100000); ++ int sso = JOptionPane.showConfirmDialog(f,ss, ++ "Check Settings", ++ JOptionPane.OK_CANCEL_OPTION, ++ JOptionPane.ERROR_MESSAGE,null); ++ if(sso == JOptionPane.OK_OPTION){ ++ ss.setNewSettings(); ++ splashThread.setInterval(80); ++ } ++ else ++ System.exit(0); ++ } ++ + private void constructWithSoap(){ + + mainMenu.setEnableFileManagers(false); +*************** +*** 157,249 **** + mysettings.updateJembossPropStrings(settings); + } + +! SwingWorker databaseworker = new SwingWorker() + { +! public Object construct() +! { +! ShowDB showdb = null; +! try +! { +! showdb = new ShowDB(mysettings); +! } +! catch (Exception ex) +! { +! splashing.doneSomething("Cannot connect!"); +! ServerSetup ss = new ServerSetup(mysettings); +! int sso = JOptionPane.showConfirmDialog(f,ss, +! "Check Settings", +! JOptionPane.OK_CANCEL_OPTION, +! JOptionPane.ERROR_MESSAGE,null); +! if(sso == JOptionPane.OK_OPTION) +! ss.setNewSettings(); +! else +! System.exit(0); + +! try +! { +! showdb = new ShowDB(mysettings); +! } +! catch (Exception exp) +! { +! exp.printStackTrace(); +! } +! } +! String showdbOut = showdb.getDBText(); + +! Database d = new Database(showdbOut); +! db = d.getDB(); +! mainMenu.setEnableFileManagers(true); +! mainMenu.setEnableShowResults(true); +! splashing.doneSomething(""); +! splashThread.setInterval(0); +! +! matrices = showdb.getMatrices(); // get the available matrices +! codons = showdb.getCodonUsage(); +! +! /*JLabel jl = */new JLabel(""); // not used but speeds first +! // ACD form loading which +! // uses html +! return null; +! } + }; + databaseworker.start(); +- + splashing.doneSomething(""); +- +- try +- { +- try +- { +- Hashtable hwoss = (new JembossJarUtil("resources/wossname.jar")).getHash(); +- if(hwoss.containsKey("wossname.out")) +- woss = new String((byte[])hwoss.get("wossname.out")); +- } +- catch (Exception ex){} +- +- if(woss.equals("")) +- { +- GetWossname ewoss = new GetWossname(mysettings); +- woss = ewoss.getWossnameText(); +- mainMenu.setEnableFileManagers(true); +- mainMenu.setEnableShowResults(true); +- } +- +- splashing.doneSomething(""); +- } +- catch(Exception e) +- { +- splashing.doneSomething("Cannot connect!"); +- ServerSetup ss = new ServerSetup(mysettings); +- int sso = JOptionPane.showConfirmDialog(f,ss, +- "Check Settings", +- JOptionPane.OK_CANCEL_OPTION, +- JOptionPane.ERROR_MESSAGE,null); +- if(sso == JOptionPane.OK_OPTION) +- ss.setNewSettings(); +- else +- System.exit(0); +- } + } + + private void constructWithoutSoap(){ + +--- 173,237 ---- + mysettings.updateJembossPropStrings(settings); + } + +! try + { +! Hashtable hwoss = (new JembossJarUtil("resources/wossname.jar")).getHash(); +! if(hwoss.containsKey("wossname.out")) +! woss = new String((byte[])hwoss.get("wossname.out")); +! } +! catch (Exception ex){} +! if(woss.equals("")) +! { +! boolean connectionmade = false; +! while (!connectionmade){ +! try +! { +! GetWossname ewoss = new GetWossname(mysettings); +! woss = ewoss.getWossnameText(); +! mainMenu.setEnableFileManagers(true); +! mainMenu.setEnableShowResults(true); +! } +! catch (JembossSoapException ex){ +! updateConnectionSettings(); +! continue; +! } +! connectionmade = true; +! } +! } + +! SwingWorker databaseworker = new SwingWorker() +! { + +! public Object construct() { +! boolean connectionmade = false; +! while (!connectionmade) { +! ShowDB showdb = null; +! try { +! showdb = new ShowDB(mysettings); +! String showdbOut = showdb.getDBText(); +! +! Database d = new Database(showdbOut); +! db = d.getDB(); +! mainMenu.setEnableFileManagers(true); +! mainMenu.setEnableShowResults(true); +! splashing.doneSomething(""); +! splashThread.setInterval(0); +! +! matrices = showdb.getMatrices(); +! codons = showdb.getCodonUsage(); +! } catch (JembossSoapException ex) { +! updateConnectionSettings(); +! continue; +! } +! connectionmade = true; +! } +! return null; +! } + }; + databaseworker.start(); + splashing.doneSomething(""); + } ++ + + private void constructWithoutSoap(){ + +*************** +*** 310,316 **** + progs = new ProgList(woss,menuBar); + + if(withSoap) +! splashing.doneSomething(""); + + int npG = progs.getNumPrimaryGroups(); + menuBar.setLayout(new GridLayout(npG,1)); +--- 298,304 ---- + progs = new ProgList(woss,menuBar); + + if(withSoap) +! splashing.doneEverything(""); + + int npG = progs.getNumPrimaryGroups(); + menuBar.setLayout(new GridLayout(npG,1)); +diff -c -N --recursive EMBOSS-6.1.0orig/jemboss/org/emboss/jemboss/gui/form/BuildJembossForm.java EMBOSS-6.1.0/jemboss/org/emboss/jemboss/gui/form/BuildJembossForm.java +*** EMBOSS-6.1.0orig/jemboss/org/emboss/jemboss/gui/form/BuildJembossForm.java 2009-07-13 17:24:04.000000000 +0100 +--- EMBOSS-6.1.0/jemboss/org/emboss/jemboss/gui/form/BuildJembossForm.java 2009-07-30 15:29:52.000000000 +0100 +*************** +*** 100,107 **** + private boolean withSoap; + private JFrame f; + private JPanel p2; +! private String embossBin; +! + private int numofFields; + private JembossParams mysettings; + +--- 100,106 ---- + private boolean withSoap; + private JFrame f; + private JPanel p2; +! + private int numofFields; + private JembossParams mysettings; + +*************** +*** 125,131 **** + this.mysettings = mysettings; + this.withSoap = withSoap; + +- embossBin = mysettings.getEmbossBin(); + this.envp = envp; + this.applName = applName; + +--- 124,129 ---- +*************** +*** 172,181 **** + { + String urlEmbassyPrefix = parseAcd.getUrlPrefix(); + url = mysettings.getembURL(); + if(urlEmbassyPrefix != null) +! url = url + "apps/release/6.0/embassy/" +applName+ "/" ; + else +! url = url + "apps/release/6.0/emboss/apps/"; + + url = url+applName+".html"; + } +--- 170,181 ---- + { + String urlEmbassyPrefix = parseAcd.getUrlPrefix(); + url = mysettings.getembURL(); ++ String version = GetVersion.getVersion(mysettings); + if(urlEmbassyPrefix != null) +! // get the version from server +! url = url + "apps/release/"+version+"/embassy/"+urlEmbassyPrefix+"/" ; + else +! url = url + "apps/release/"+version+"/emboss/apps/"; + + url = url+applName+".html"; + } +*************** +*** 893,900 **** + } + else if ( att.startsWith("float") ) + { +! if( (textFloat[h].getText() != null) && textFloat[h].isVisible() +! && textFloat[h].isEnabled()) + { + options = options.concat(" -" + val + " " + textFloat[h].getValue()); + optionsA.add("-"+val); +--- 893,901 ---- + } + else if ( att.startsWith("float") ) + { +! if( textFloat[h].getText() != null && +! textFloat[h].getText().length()>0 && +! textFloat[h].isVisible() && textFloat[h].isEnabled()) + { + options = options.concat(" -" + val + " " + textFloat[h].getValue()); + optionsA.add("-"+val); +diff -c -N --recursive EMBOSS-6.1.0orig/jemboss/org/emboss/jemboss/gui/sequenceChooser/InputSequenceAttributes.java EMBOSS-6.1.0/jemboss/org/emboss/jemboss/gui/sequenceChooser/InputSequenceAttributes.java +*** EMBOSS-6.1.0orig/jemboss/org/emboss/jemboss/gui/sequenceChooser/InputSequenceAttributes.java 2009-07-13 17:23:30.000000000 +0100 +--- EMBOSS-6.1.0/jemboss/org/emboss/jemboss/gui/sequenceChooser/InputSequenceAttributes.java 2009-07-30 15:30:07.000000000 +0100 +*************** +*** 281,287 **** + // bx.add(Box.createHorizontalGlue()); + + +! UFO = new JTextField(); //sufo + UFO.setPreferredSize(new Dimension(100, 30)); + UFO.setMaximumSize(new Dimension(100, 30)); + +--- 281,287 ---- + // bx.add(Box.createHorizontalGlue()); + + +! UFO = new JTextField(); //ufo + UFO.setPreferredSize(new Dimension(100, 30)); + UFO.setMaximumSize(new Dimension(100, 30)); + +*************** +*** 433,440 **** + + /** + * +! * Determine if there is a default -sufo value +! * @return true if -sufo is set + * + */ + public boolean isUFODefault() +--- 433,440 ---- + + /** + * +! * Determine if there is a default -ufo value +! * @return true if -ufo is set + * + */ + public boolean isUFODefault() +*************** +*** 508,514 **** + // sID.getText()); + + if(!isUFODefault()) +! options = options.concat(" -sufo" + seq + " " + + UFO.getText()); + + return options; +--- 508,514 ---- + // sID.getText()); + + if(!isUFODefault()) +! options = options.concat(" -ufo" + seq + " " + + UFO.getText()); + + return options; +*************** +*** 559,565 **** + } + + if(!isUFODefault()){ +! optionsA.add("-sufo"+ seq); + optionsA.add(UFO.getText()); + } + +--- 559,565 ---- + } + + if(!isUFODefault()){ +! optionsA.add("-ufo"+ seq); + optionsA.add(UFO.getText()); + } + +diff -c -N --recursive EMBOSS-6.1.0orig/jemboss/org/emboss/jemboss/soap/GetVersion.java EMBOSS-6.1.0/jemboss/org/emboss/jemboss/soap/GetVersion.java +*** EMBOSS-6.1.0orig/jemboss/org/emboss/jemboss/soap/GetVersion.java 1970-01-01 01:00:00.000000000 +0100 +--- EMBOSS-6.1.0/jemboss/org/emboss/jemboss/soap/GetVersion.java 2009-07-30 15:30:24.000000000 +0100 +*************** +*** 0 **** +--- 1,82 ---- ++ /******************************************************************** ++ * ++ * This library is free software; you can redistribute it and/or ++ * modify it under the terms of the GNU Library General Public ++ * License as published by the Free Software Foundation; either ++ * version 2 of the License, or (at your option) any later version. ++ * ++ * This library is distributed in the hope that it will be useful, ++ * but WITHOUT ANY WARRANTY; without even the implied warranty of ++ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU ++ * Library General Public License for more details. ++ * ++ * You should have received a copy of the GNU Library General Public ++ * License along with this library; if not, write to the ++ * Free Software Foundation, Inc., 59 Temple Place - Suite 330, ++ * Boston, MA 02111-1307, USA. ++ * ++ * @author: Copyright (C) Tim Carver ++ * ++ ********************************************************************/ ++ ++ package org.emboss.jemboss.soap; ++ ++ import javax.xml.namespace.QName; ++ ++ import org.apache.axis.client.Call; ++ import org.emboss.jemboss.JembossParams; ++ ++ /** ++ * ++ * Get the version of EMBOSS programs used by the Jemboss server connected ++ * ++ */ ++ /** ++ * @author uludag ++ * ++ */ ++ public class GetVersion { ++ ++ private static String version = null; ++ ++ /** ++ * returns complete version string of EMBOSS connected Jemboss server is using ++ * @param mysettings ++ * jemboss properties ++ * ++ */ ++ public static String getVersionComplete(JembossParams mysettings) { ++ ++ if (version != null) ++ return version; ++ ++ if (!JembossParams.isJembossServer()) ++ return null; ++ try { ++ String endpoint = mysettings.getPublicSoapURL(); ++ org.apache.axis.client.Service serv = new org.apache.axis.client.Service(); ++ ++ Call call = (Call) serv.createCall(); ++ call.setTargetEndpointAddress(new java.net.URL(endpoint)); ++ call.setOperationName(new QName(mysettings.getPublicSoapService(), ++ "version")); ++ call.setReturnType(org.apache.axis.Constants.SOAP_STRING); ++ version = (String) call.invoke(new Object[] {}); ++ } catch (Exception jse) { ++ jse.printStackTrace(); ++ } ++ return version; ++ } ++ ++ ++ /** ++ * returns firt two digits of EMBOSS version connected server has ++ * @param mysettings ++ * @return version of EMBOSS programs such as 5.0, or 6.1 ++ */ ++ public static String getVersion(JembossParams mysettings){ ++ getVersionComplete(mysettings); ++ return version.split("\\.")[0]+"."+version.split("\\.")[1]; ++ } ++ ++ } +diff -c -N --recursive EMBOSS-6.1.0orig/jemboss/org/emboss/jemboss/soap/ShowDB.java EMBOSS-6.1.0/jemboss/org/emboss/jemboss/soap/ShowDB.java +*** EMBOSS-6.1.0orig/jemboss/org/emboss/jemboss/soap/ShowDB.java 2008-06-12 09:19:07.000000000 +0100 +--- EMBOSS-6.1.0/jemboss/org/emboss/jemboss/soap/ShowDB.java 2009-07-30 15:30:32.000000000 +0100 +*************** +*** 50,64 **** + * @param mysettings jemboss properties + * + */ +! public ShowDB(JembossParams mysettings) + { + + PublicRequest dbReq = null; +! try +! { +! dbReq = new PublicRequest(mysettings, "show_db"); +! } +! catch (JembossSoapException jse) {} + + statusmsg = dbReq.getVal("msg"); + status = dbReq.getVal("status"); +--- 50,61 ---- + * @param mysettings jemboss properties + * + */ +! public ShowDB(JembossParams mysettings) throws JembossSoapException + { + + PublicRequest dbReq = null; +! +! dbReq = new PublicRequest(mysettings, "show_db"); + + statusmsg = dbReq.getVal("msg"); + status = dbReq.getVal("status"); +diff -c -N --recursive EMBOSS-6.1.0orig/jemboss/utils/install-jemboss-server.sh EMBOSS-6.1.0/jemboss/utils/install-jemboss-server.sh +*** EMBOSS-6.1.0orig/jemboss/utils/install-jemboss-server.sh 2009-06-30 09:31:50.000000000 +0100 +--- EMBOSS-6.1.0/jemboss/utils/install-jemboss-server.sh 2009-07-30 15:30:59.000000000 +0100 +*************** +*** 694,718 **** + echo " EMBOSS and Jemboss Server installation script" + echo "--------------------------------------------------------------" + echo " " +! echo "Note: any default values are given in square brackets []. " + echo " " +! echo "There are two types of installation see details at: " + echo "http://emboss.sourceforge.net/Jemboss/install/setup.html" +- echo " " +- echo "(1) CLIENT-SERVER" +- echo "(2) STANDALONE" +- echo "Enter type of installation [1] :" +- read INSTALL_TYPE +- +- if (test "$INSTALL_TYPE" != "1") && (test "$INSTALL_TYPE" != "2"); then +- INSTALL_TYPE="1" +- fi +- clear +- + echo +- echo "--------------------------------------------------------------" +- echo " EMBOSS and Jemboss Server installation script" +- echo "--------------------------------------------------------------" + echo + echo "*** This script needs to be run with permissions to be able" + echo "*** to install EMBOSS in the required directories. This may" +--- 694,709 ---- + echo " EMBOSS and Jemboss Server installation script" + echo "--------------------------------------------------------------" + echo " " +! echo "Note: any default values are given in square brackets []." + echo " " +! echo "This script installs EMBOSS as well as Jemboss." +! echo "Jemboss is deployed as a Java web application in your tomcat server." +! echo "A script is prepared to run Jemboss client that by default uses the" +! echo "above Jemboss web application." +! echo +! echo "For detailed information on installing Jemboss see: " + echo "http://emboss.sourceforge.net/Jemboss/install/setup.html" + echo + echo + echo "*** This script needs to be run with permissions to be able" + echo "*** to install EMBOSS in the required directories. This may" +*************** +*** 721,735 **** + echo "Before running this script you should download the latest:" + echo + echo "(1) EMBOSS release (contains Jemboss) ftp://emboss.open-bio.org/pub/EMBOSS/" +! +! +! if [ $INSTALL_TYPE = "1" ]; then +! echo "(2) Tomcat release http://jakarta.apache.org/site/binindex.html" +! echo "(3) Apache AXIS (SOAP) release http://xml.apache.org/axis/" +! fi + + echo +! echo "Has the above been downloaded (y/n)? " + read DOWNLOADED + + if (test "$DOWNLOADED" != "y") && (test "$DOWNLOADED" != "Y"); then +--- 712,722 ---- + echo "Before running this script you should download the latest:" + echo + echo "(1) EMBOSS release (contains Jemboss) ftp://emboss.open-bio.org/pub/EMBOSS/" +! echo "(2) Tomcat 5.5 series release http://tomcat.apache.org/" +! echo "(3) Apache AXIS (SOAP) release 1.4 http://ws.apache.org/axis/" + + echo +! echo "Have the above been downloaded (y/n)? " + read DOWNLOADED + + if (test "$DOWNLOADED" != "y") && (test "$DOWNLOADED" != "Y"); then +*************** +*** 831,836 **** +--- 818,826 ---- + fi + + SSL="y" ++ ++ # keep the following variable for now so we have cvs compare for a while ++ INSTALL_TYPE="1"; + if [ $INSTALL_TYPE = "1" ]; then + # + # localhost name +*************** +*** 1271,1287 **** + #cd $EMBOSS_INSTALL/share/EMBOSS/jemboss + JEMBOSS=$EMBOSS_INSTALL/share/EMBOSS/jemboss + +- #--------------------------------------------------------------------------------- +- # Exit for standalone installations +- #--------------------------------------------------------------------------------- +- if [ $INSTALL_TYPE = "2" ]; then +- echo +- echo "To run Jemboss:" +- echo "cd $JEMBOSS" +- echo "./runJemboss.sh" +- echo +- exit 0 +- fi + + + # +--- 1261,1266 ---- +diff -c -N --recursive EMBOSS-6.1.0orig/nucleus/embaln.c EMBOSS-6.1.0/nucleus/embaln.c +*** EMBOSS-6.1.0orig/nucleus/embaln.c 2009-06-12 19:02:30.000000000 +0100 +--- EMBOSS-6.1.0/nucleus/embaln.c 2009-08-25 09:31:28.000000000 +0100 +*************** +*** 2091,2096 **** +--- 2091,2098 ---- + ajStrAppendK(m,p[row--]); + ajStrAppendK(n,q[column--]); + ++ if(row < 0 || column < 0) ++ break; + if(path[(row)*seqlen+(column)]<=0.) + break; + --- emboss-6.1.0.orig/debian/patches/transient-vectorstrip.patch +++ emboss-6.1.0/debian/patches/transient-vectorstrip.patch @@ -0,0 +1,19 @@ +Description: Makes vectorsctrip retain quality scores. + This patch or an equivalent solution has been applied Upstream. + https://sourceforge.net/tracker/index.php?func=detail&aid=2886368&group_id=93650&atid=605034 +Origin: http://lists.open-bio.org/pipermail/emboss/2009-September/003735.html +--- emboss-6.1.0.orig/ajax/ajseq.c ++++ emboss-6.1.0/ajax/ajseq.c +@@ -782,6 +782,12 @@ + if (seq->Fttable) + pthis->Fttable = ajFeattableCopy(seq->Fttable); + ++ if (seq->Accuracy) ++ { ++ AJCNEW0(pthis->Accuracy,seq->Seq->Len); ++ memmove(pthis->Accuracy,seq->Accuracy,seq->Seq->Len*sizeof(float)); ++ } ++ + return pthis; + } + --- emboss-6.1.0.orig/debian/manpages/tcode.1e +++ emboss-6.1.0/debian/manpages/tcode.1e @@ -0,0 +1,87 @@ +'\" t +.\" Title: TCODE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "TCODE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +tcode \- Identify protein\-coding regions using Fickett TESTCODE statistic +.SH "SYNOPSIS" +.HP \w'\fBtcode\fR\ 'u +\fBtcode\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-datafile\ \fR\fB\fIdatafile\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-step\ \fR\fB\fIinteger\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR +.HP \w'\fBtcode\fR\ 'u +\fBtcode\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBtcode\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Gene finding" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fIdatafile\fR +.RS 4 +The default data file is Etcode\&.dat and contains coding probabilities for each base\&. The probabilities are for both positional and compositional information\&. Default value: Etcode\&.dat +.RE +.SS "Required section" +.PP +\fB\-window\fR \fIinteger\fR +.RS 4 +This is the number of nucleotide bases over which the TESTCODE statistic will be performed each time\&. The window will then slide along the sequence, covering the same number of bases each time\&. Default value: 200 +.RE +.SS "Advanced section" +.PP +\fB\-step\fR \fIinteger\fR +.RS 4 +The selected window will, by default, slide along the nucleotide sequence by three bases at a time, retaining the frame (although the algorithm is not frame sensitive)\&. This may be altered to increase or decrease the increment of the slide\&. Default value: 3 +.RE +.SS "Output section" +.PP +\fB\-plot\fR \fItoggle\fR +.RS 4 +On selection a graph of the sequence (X axis) plotted against the coding score (Y axis) will be displayed\&. Sequence above the green line is coding, that below the red line is non\-coding\&. Default value: N +.RE +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +tcode is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/ajbad.1e +++ emboss-6.1.0/debian/manpages/ajbad.1e @@ -0,0 +1,99 @@ +'\" t +.\" Title: AJBAD +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "AJBAD" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +ajbad \- Test file for ACD parsing +.SH "SYNOPSIS" +.HP \w'\fBajbad\fR\ 'u +\fBajbad\fR \fB\-typea\ \fR\fB\fIstring\fR\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR \fB\-eco\ \fR\fB\fIcodon\fR\fR \fB\-typeb\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-a\ \fR\fB\fIinteger\fR\fR \fB\-b\ \fR\fB\fIinteger\fR\fR \fB\-c\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBajbad\fR\ 'u +\fBajbad\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBajbad\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-typea\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-bsequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-eco\fR \fIcodon\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-typeb\fR \fIstring\fR +.RS 4 +Default value: $(seqa\&.type) +.RE +.PP +\fB\-date\fR \fIstring\fR +.RS 4 +Default value: 00/00/00 +.RE +.SS "Advanced section" +.PP +\fB\-a\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-b\fR \fIinteger\fR +.RS 4 +Default value: 15 +.RE +.PP +\fB\-c\fR \fIfloat\fR +.RS 4 +Default value: 1\&.6 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +ajbad is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/prophecy.1e +++ emboss-6.1.0/debian/manpages/prophecy.1e @@ -0,0 +1,94 @@ +'\" t +.\" Title: PROPHECY +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PROPHECY" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +prophecy \- Create frequency matrix or profile from a multiple alignment +.SH "SYNOPSIS" +.HP \w'\fBprophecy\fR\ 'u +\fBprophecy\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR \fB\-type\ \fR\fB\fIlist\fR\fR \fB\-datafile\ \fR\fB\fImatrixf\fR\fR \fB\-name\ \fR\fB\fIstring\fR\fR \fB\-threshold\ \fR\fB\fIinteger\fR\fR \fB\-open\ \fR\fB\fIfloat\fR\fR \fB\-extension\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBprophecy\fR\ 'u +\fBprophecy\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBprophecy\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Profiles,Protein:Profiles" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqset\fR +.RS 4 +.RE +.PP +\fB\-type\fR \fIlist\fR +.RS 4 +Default value: F +.RE +.PP +\fB\-datafile\fR \fImatrixf\fR +.RS 4 +Default value: @($(type) = G: Epprofile H: EBLOSUM62 F: EBLOSUM62) +.RE +.SS "Required section" +.PP +\fB\-name\fR \fIstring\fR +.RS 4 +Default value: mymatrix +.RE +.SS "Profile type specific options" +.PP +\fB\-threshold\fR \fIinteger\fR +.RS 4 +Default value: 75 +.RE +.SS "Gap options" +.PP +\fB\-open\fR \fIfloat\fR +.RS 4 +Default value: 3\&.0 +.RE +.PP +\fB\-extension\fR \fIfloat\fR +.RS 4 +Default value: 0\&.3 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +prophecy is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/treetypedisplay.1e +++ emboss-6.1.0/debian/manpages/treetypedisplay.1e @@ -0,0 +1,56 @@ +'\" t +.\" Title: TREETYPEDISPLAY +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "TREETYPEDISPLAY" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +treetypedisplay \- Test of graphics +.SH "SYNOPSIS" +.HP \w'\fBtreetypedisplay\fR\ 'u +\fBtreetypedisplay\fR \fB\-graph\ \fR\fB\fIgraph\fR\fR +.HP \w'\fBtreetypedisplay\fR\ 'u +\fBtreetypedisplay\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBtreetypedisplay\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Output section" +.PP +\fB\-graph\fR \fIgraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +treetypedisplay is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/skipseq.1e +++ emboss-6.1.0/debian/manpages/skipseq.1e @@ -0,0 +1,69 @@ +'\" t +.\" Title: SKIPSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SKIPSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +skipseq \- Reads and writes (returns) sequences, skipping first few +.SH "SYNOPSIS" +.HP \w'\fBskipseq\fR\ 'u +\fBskipseq\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-skip\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBskipseq\fR\ 'u +\fBskipseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBskipseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-feature\fR \fIboolean\fR +.RS 4 +.RE +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-skip\fR \fIinteger\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +skipseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/wordmatch.1e +++ emboss-6.1.0/debian/manpages/wordmatch.1e @@ -0,0 +1,79 @@ +'\" t +.\" Title: WORDMATCH +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "WORDMATCH" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +wordmatch \- Finds regions of identity (exact matches) of two sequences +.SH "SYNOPSIS" +.HP \w'\fBwordmatch\fR\ 'u +\fBwordmatch\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIalign\fR\fR \fB\-aoutfeat\ \fR\fB\fIfeatout\fR\fR \fB\-boutfeat\ \fR\fB\fIfeatout\fR\fR +.HP \w'\fBwordmatch\fR\ 'u +\fBwordmatch\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBwordmatch\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Local" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-asequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-bsequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-wordsize\fR \fIinteger\fR +.RS 4 +Default value: 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIalign\fR +.RS 4 +.RE +.PP +\fB\-aoutfeat\fR \fIfeatout\fR +.RS 4 +.RE +.PP +\fB\-boutfeat\fR \fIfeatout\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +wordmatch is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/btwisted.1e +++ emboss-6.1.0/debian/manpages/btwisted.1e @@ -0,0 +1,71 @@ +'\" t +.\" Title: BTWISTED +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "BTWISTED" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +btwisted \- Calculate the twisting in a B\-DNA sequence +.SH "SYNOPSIS" +.HP \w'\fBbtwisted\fR\ 'u +\fBbtwisted\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-angledata\ \fR\fB\fIdatafile\fR\fR \fB\-energydata\ \fR\fB\fIdatafile\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBbtwisted\fR\ 'u +\fBbtwisted\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBbtwisted\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-angledata\fR \fIdatafile\fR +.RS 4 +Default value: Eangles\&.dat +.RE +.PP +\fB\-energydata\fR \fIdatafile\fR +.RS 4 +Default value: Eenergy\&.dat +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +btwisted is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/biosed.1e +++ emboss-6.1.0/debian/manpages/biosed.1e @@ -0,0 +1,82 @@ +'\" t +.\" Title: BIOSED +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "BIOSED" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +biosed \- Replace or delete sequence sections +.SH "SYNOPSIS" +.HP \w'\fBbiosed\fR\ 'u +\fBbiosed\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-target\ \fR\fB\fIstring\fR\fR \fB\-delete\ \fR\fB\fItoggle\fR\fR \fB\-replace\ \fR\fB\fIstring\fR\fR [\fB\-position\ \fR\fB\fIinteger\fR\fR] \fB\-outseq\ \fR\fB\fIseqout\fR\fR +.HP \w'\fBbiosed\fR\ 'u +\fBbiosed\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBbiosed\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-target\fR \fIstring\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-delete\fR \fItoggle\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-replace\fR \fIstring\fR +.RS 4 +Default value: A +.RE +.SS "Additional section" +.PP +\fB\-position\fR \fIinteger\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +biosed is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/pasteseq.1e +++ emboss-6.1.0/debian/manpages/pasteseq.1e @@ -0,0 +1,71 @@ +'\" t +.\" Title: PASTESEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PASTESEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +pasteseq \- Insert one sequence into another +.SH "SYNOPSIS" +.HP \w'\fBpasteseq\fR\ 'u +\fBpasteseq\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR \fB\-pos\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR +.HP \w'\fBpasteseq\fR\ 'u +\fBpasteseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBpasteseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-asequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-bsequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-pos\fR \fIinteger\fR +.RS 4 +The position in the main input sequence to insert after\&. To insert before the start use the position 0\&. Default value: $(asequence\&.end) +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +pasteseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/seqretallfeat.1e +++ emboss-6.1.0/debian/manpages/seqretallfeat.1e @@ -0,0 +1,61 @@ +'\" t +.\" Title: SEQRETALLFEAT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SEQRETALLFEAT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +seqretallfeat \- Reads and writes (returns) one or more sequences +.SH "SYNOPSIS" +.HP \w'\fBseqretallfeat\fR\ 'u +\fBseqretallfeat\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBseqretallfeat\fR\ 'u +\fBseqretallfeat\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBseqretallfeat\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +seqretallfeat is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/demosequence.1e +++ emboss-6.1.0/debian/manpages/demosequence.1e @@ -0,0 +1,52 @@ +'\" t +.\" Title: DEMOSEQUENCE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DEMOSEQUENCE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +demosequence \- Demonstration of the sequence functions +.SH "SYNOPSIS" +.HP \w'\fBdemosequence\fR\ 'u +\fBdemosequence\fR +.HP \w'\fBdemosequence\fR\ 'u +\fBdemosequence\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdemosequence\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +demosequence is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/acdtable.1e +++ emboss-6.1.0/debian/manpages/acdtable.1e @@ -0,0 +1,51 @@ +'\" t +.\" Title: ACDTABLE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ACDTABLE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +acdtable \- Generate an HTML table of parameters from an application ACD file +.SH "SYNOPSIS" +.HP \w'\fBacdtable\fR\ 'u +\fBacdtable\fR +.HP \w'\fBacdtable\fR\ 'u +\fBacdtable\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBacdtable\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd" command group(s)\&. +.SH "OPTIONS" +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +acdtable is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/tfm.1e +++ emboss-6.1.0/debian/manpages/tfm.1e @@ -0,0 +1,73 @@ +'\" t +.\" Title: TFM +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "TFM" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +tfm \- Displays full documentation for an application +.SH "SYNOPSIS" +.HP \w'\fBtfm\fR\ 'u +\fBtfm\fR \fB\-program\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR] [\fB\-more\ \fR\fB\fIboolean\fR\fR] +.HP \w'\fBtfm\fR\ 'u +\fBtfm\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBtfm\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-program\fR \fIstring\fR +.RS 4 +Enter the name of an EMBOSS program +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +Default value: stdout +.RE +.PP +\fB\-html\fR \fIboolean\fR +.RS 4 +This will format the output for displaying as a WWW document\&. Default value: N +.RE +.PP +\fB\-more\fR \fIboolean\fR +.RS 4 +This uses the standard UNIX utility \'more\' to display the text page\-by\-page, waiting for you to read one screen\-full before going on to the next page\&. When you have finished reading a page, press the SPACE bar to proceed to the next page\&. Default value: @(!$(html)) +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +tfm is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/ajfeatest.1e +++ emboss-6.1.0/debian/manpages/ajfeatest.1e @@ -0,0 +1,61 @@ +'\" t +.\" Title: AJFEATEST +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "AJFEATEST" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +ajfeatest \- Reads and writes (returns) a sequence and its features +.SH "SYNOPSIS" +.HP \w'\fBajfeatest\fR\ 'u +\fBajfeatest\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR +.HP \w'\fBajfeatest\fR\ 'u +\fBajfeatest\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBajfeatest\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +ajfeatest is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/embossdata.1e +++ emboss-6.1.0/debian/manpages/embossdata.1e @@ -0,0 +1,77 @@ +'\" t +.\" Title: EMBOSSDATA +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "EMBOSSDATA" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +embossdata \- Find and retrieve EMBOSS data files +.SH "SYNOPSIS" +.HP \w'\fBembossdata\fR\ 'u +\fBembossdata\fR [\fB\-showall\ \fR\fB\fItoggle\fR\fR] \fB\-fetch\ \fR\fB\fIboolean\fR\fR \fB\-filename\ \fR\fB\fIstring\fR\fR \fB\-reject\ \fR\fB\fIselection\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] +.HP \w'\fBembossdata\fR\ 'u +\fBembossdata\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBembossdata\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-showall\fR \fItoggle\fR +.RS 4 +.RE +.PP +\fB\-fetch\fR \fIboolean\fR +.RS 4 +.RE +.PP +\fB\-filename\fR \fIstring\fR +.RS 4 +This specifies the name of the file that should be fetched into the current directory or searched for in all of the directories that EMBOSS programs search when looking for a data file\&. The name of the file is not altered when it is fetched\&. +.RE +.SS "Advanced section" +.PP +\fB\-reject\fR \fIselection\fR +.RS 4 +This specifies the names of the sub\-directories of the EMBOSS data directory that should be ignored when displaying data directories\&. Default value: 3, 5, 6 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +This specifies the name of the file that the results of a search for a file in the various data directories is written to\&. By default these results are written to the screen (stdout)\&. Default value: stdout +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +embossdata is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/splitter.1e +++ emboss-6.1.0/debian/manpages/splitter.1e @@ -0,0 +1,82 @@ +'\" t +.\" Title: SPLITTER +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SPLITTER" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +splitter \- Split sequence(s) into smaller sequences +.SH "SYNOPSIS" +.HP \w'\fBsplitter\fR\ 'u +\fBsplitter\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-size\ \fR\fB\fIinteger\fR\fR] [\fB\-overlap\ \fR\fB\fIinteger\fR\fR] \fB\-addoverlap\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBsplitter\fR\ 'u +\fBsplitter\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBsplitter\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-feature\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-size\fR \fIinteger\fR +.RS 4 +Default value: 10000 +.RE +.PP +\fB\-overlap\fR \fIinteger\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-addoverlap\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +splitter is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/infoalign.1e +++ emboss-6.1.0/debian/manpages/infoalign.1e @@ -0,0 +1,159 @@ +'\" t +.\" Title: INFOALIGN +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "INFOALIGN" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +infoalign \- Display basic information about a multiple sequence alignment +.SH "SYNOPSIS" +.HP \w'\fBinfoalign\fR\ 'u +\fBinfoalign\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR [\fB\-matrix\ \fR\fB\fImatrix\fR\fR] [\fB\-refseq\ \fR\fB\fIstring\fR\fR] \fB\-plurality\ \fR\fB\fIfloat\fR\fR \fB\-identity\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR [\fB\-html\ \fR\fB\fIboolean\fR\fR] \fB\-only\ \fR\fB\fIboolean\fR\fR \fB\-heading\ \fR\fB\fIboolean\fR\fR \fB\-usa\ \fR\fB\fIboolean\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-seqlength\ \fR\fB\fIboolean\fR\fR \fB\-alignlength\ \fR\fB\fIboolean\fR\fR \fB\-gaps\ \fR\fB\fIboolean\fR\fR \fB\-gapcount\ \fR\fB\fIboolean\fR\fR \fB\-idcount\ \fR\fB\fIboolean\fR\fR \fB\-simcount\ \fR\fB\fIboolean\fR\fR \fB\-diffcount\ \fR\fB\fIboolean\fR\fR \fB\-change\ \fR\fB\fIboolean\fR\fR \fB\-weight\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR +.HP \w'\fBinfoalign\fR\ 'u +\fBinfoalign\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBinfoalign\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Multiple,Information" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqset\fR +.RS 4 +The sequence alignment to be displayed\&. +.RE +.PP +\fB\-matrix\fR \fImatrix\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.PP +\fB\-refseq\fR \fIstring\fR +.RS 4 +If you give the number in the alignment or the name of a sequence, it will be taken to be the reference sequence\&. The reference sequence is the one against which all the other sequences are compared\&. If this is set to 0 then the consensus sequence will be used as the reference sequence\&. By default the consensus sequence is used as the reference sequence\&. +.RE +.SS "Advanced section" +.PP +\fB\-plurality\fR \fIfloat\fR +.RS 4 +Set a cut\-off for the % of positive scoring matches below which there is no consensus\&. The default plurality is taken as 50% of the total weight of all the sequences in the alignment\&. Default value: 50\&.0 +.RE +.PP +\fB\-identity\fR \fIfloat\fR +.RS 4 +Provides the facility of setting the required number of identities at a position for it to give a consensus\&. Therefore, if this is set to 100% only columns of identities contribute to the consensus\&. Default value: 0\&.0 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +If you enter the name of a file here then this program will write the sequence details into that file\&. +.RE +.PP +\fB\-html\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-only\fR \fIboolean\fR +.RS 4 +This is a way of shortening the command line if you only want a few things to be displayed\&. Instead of specifying: \'\-nohead \-nousa \-noname \-noalign \-nogaps \-nogapcount \-nosimcount \-noidcount \-nodiffcount \-noweight\' to get only the sequence length output, you can specify \'\-only \-seqlength\' Default value: N +.RE +.PP +\fB\-heading\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-usa\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-name\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-seqlength\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-alignlength\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-gaps\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-gapcount\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-idcount\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-simcount\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-diffcount\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-change\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-weight\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-description\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +infoalign is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/dbxgcg.1e +++ emboss-6.1.0/debian/manpages/dbxgcg.1e @@ -0,0 +1,106 @@ +'\" t +.\" Title: DBXGCG +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DBXGCG" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +dbxgcg \- Index a GCG formatted database using b+tree indices +.SH "SYNOPSIS" +.HP \w'\fBdbxgcg\fR\ 'u +\fBdbxgcg\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBdbxgcg\fR\ 'u +\fBdbxgcg\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdbxgcg\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database indexing" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-dbname\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-dbresource\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-idformat\fR \fIlist\fR +.RS 4 +Default value: SWISS +.RE +.PP +\fB\-directory\fR \fIdirectory\fR +.RS 4 +Default value: \&. +.RE +.PP +\fB\-filenames\fR \fIstring\fR +.RS 4 +Default value: *\&.seq +.RE +.SS "Required section" +.PP +\fB\-fields\fR \fIlist\fR +.RS 4 +Default value: id,acc +.RE +.SS "Advanced section" +.PP +\fB\-release\fR \fIstring\fR +.RS 4 +Default value: 0\&.0 +.RE +.PP +\fB\-date\fR \fIstring\fR +.RS 4 +Default value: 00/00/00 +.RE +.PP +\fB\-exclude\fR \fIstring\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-indexoutdir\fR \fIoutdir\fR +.RS 4 +Default value: \&. +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +dbxgcg is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/tmap.1e +++ emboss-6.1.0/debian/manpages/tmap.1e @@ -0,0 +1,66 @@ +'\" t +.\" Title: TMAP +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "TMAP" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +tmap \- Predict and plot transmembrane segments in protein sequences +.SH "SYNOPSIS" +.HP \w'\fBtmap\fR\ 'u +\fBtmap\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBtmap\fR\ 'u +\fBtmap\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBtmap\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:2D Structure" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequences\fR \fIseqset\fR +.RS 4 +File containing a sequence alignment +.RE +.SS "Output section" +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +tmap is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/twofeat.1e +++ emboss-6.1.0/debian/manpages/twofeat.1e @@ -0,0 +1,174 @@ +'\" t +.\" Title: TWOFEAT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "TWOFEAT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +twofeat \- Finds neighbouring pairs of features in sequence(s) +.SH "SYNOPSIS" +.HP \w'\fBtwofeat\fR\ 'u +\fBtwofeat\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-asource\ \fR\fB\fIstring\fR\fR] \fB\-atype\ \fR\fB\fIstring\fR\fR [\fB\-asense\ \fR\fB\fIlist\fR\fR] [\fB\-aminscore\ \fR\fB\fIfloat\fR\fR] [\fB\-amaxscore\ \fR\fB\fIfloat\fR\fR] [\fB\-atag\ \fR\fB\fIstring\fR\fR] [\fB\-avalue\ \fR\fB\fIstring\fR\fR] [\fB\-bsource\ \fR\fB\fIstring\fR\fR] \fB\-btype\ \fR\fB\fIstring\fR\fR [\fB\-bsense\ \fR\fB\fIlist\fR\fR] [\fB\-bminscore\ \fR\fB\fIfloat\fR\fR] [\fB\-bmaxscore\ \fR\fB\fIfloat\fR\fR] [\fB\-btag\ \fR\fB\fIstring\fR\fR] [\fB\-bvalue\ \fR\fB\fIstring\fR\fR] [\fB\-overlap\ \fR\fB\fIlist\fR\fR] \fB\-minrange\ \fR\fB\fIinteger\fR\fR \fB\-maxrange\ \fR\fB\fIinteger\fR\fR [\fB\-rangetype\ \fR\fB\fIlist\fR\fR] [\fB\-sense\ \fR\fB\fIlist\fR\fR] [\fB\-order\ \fR\fB\fIlist\fR\fR] [\fB\-twoout\ \fR\fB\fItoggle\fR\fR] \fB\-typeout\ \fR\fB\fIstring\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBtwofeat\fR\ 'u +\fBtwofeat\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBtwofeat\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Feature tables" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "First feature options" +.PP +\fB\-asource\fR \fIstring\fR +.RS 4 +By default any feature source in the feature table is allowed\&. You can set this to match any feature source you wish to allow\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \'*\'\&. If you wish to allow more than one source, separate their names with the character \'|\', eg: gene* | embl Default value: * +.RE +.PP +\fB\-atype\fR \fIstring\fR +.RS 4 +By default every feature in the feature table is allowed\&. You can set this to be any feature type you wish to allow\&. See http://www3\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.ch/txt/userman\&.txt for a list of the Swissprot feature types\&. The type may be wildcarded by using \'*\'\&. If you wish to allow more than one type, separate their names with the character \'|\', eg: *UTR | intron Default value: * +.RE +.PP +\fB\-asense\fR \fIlist\fR +.RS 4 +By default any feature sense is allowed\&. You can set this to match the required sense\&. +.RE +.PP +\fB\-aminscore\fR \fIfloat\fR +.RS 4 +If this is greater than or equal to the maximum score, then any score is allowed\&. Default value: 0\&.0 +.RE +.PP +\fB\-amaxscore\fR \fIfloat\fR +.RS 4 +If this is less than or equal to the maximum score, then any score is permitted\&. Default value: 0\&.0 +.RE +.PP +\fB\-atag\fR \fIstring\fR +.RS 4 +Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Some of these tags also have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag in the feature table is allowed\&. You can set this to match any feature tag you wish to allow\&. The tag may be wildcarded by using \'*\'\&. If you wish to allow more than one tag, separate their names with the character \'|\', eg: gene | label Default value: * +.RE +.PP +\fB\-avalue\fR \fIstring\fR +.RS 4 +Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Only some of these tags can have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag value in the feature table is allowed\&. You can set this to match any feature tag value you wish to allow\&. The tag value may be wildcarded by using \'*\'\&. If you wish to allow more than one tag value, separate their names with the character \'|\', eg: pax* | 10 Default value: * +.RE +.SS "Second feature options" +.PP +\fB\-bsource\fR \fIstring\fR +.RS 4 +By default any feature source in the feature table is allowed\&. You can set this to match any feature source you wish to allow\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \'*\'\&. If you wish to allow more than one source, separate their names with the character \'|\', eg: gene* | embl Default value: * +.RE +.PP +\fB\-btype\fR \fIstring\fR +.RS 4 +By default every feature in the feature table is allowed\&. You can set this to be any feature type you wish to allow\&. See http://www3\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.ch/txt/userman\&.txt for a list of the Swissprot feature types\&. The type may be wildcarded by using \'*\'\&. If you wish to allow more than one type, separate their names with the character \'|\', eg: *UTR | intron Default value: * +.RE +.PP +\fB\-bsense\fR \fIlist\fR +.RS 4 +By default any feature sense is allowed\&. You can set this to match the required sense\&. +.RE +.PP +\fB\-bminscore\fR \fIfloat\fR +.RS 4 +If this is greater than or equal to the maximum score, then any score is allowed\&. Default value: 0\&.0 +.RE +.PP +\fB\-bmaxscore\fR \fIfloat\fR +.RS 4 +If this is less than or equal to the maximum score, then any score is permitted\&. Default value: 0\&.0 +.RE +.PP +\fB\-btag\fR \fIstring\fR +.RS 4 +Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Some of these tags also have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag in the feature table is allowed\&. You can set this to match any feature tag you wish to allow\&. The tag may be wildcarded by using \'*\'\&. If you wish to allow more than one tag, separate their names with the character \'|\', eg: gene | label Default value: * +.RE +.PP +\fB\-bvalue\fR \fIstring\fR +.RS 4 +Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Only some of these tags can have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag value in the feature table is allowed\&. You can set this to match any feature tag value you wish to allow\&. The tag value may be wildcarded by using \'*\'\&. If you wish to allow more than one tag value, separate their names with the character \'|\', eg: pax* | 10 Default value: * +.RE +.SS "Feature relation options" +.PP +\fB\-overlap\fR \fIlist\fR +.RS 4 +This allows you to specify the allowed overlaps of the features A and B\&. You can allow any or no overlaps, specify that they must or must not overlap, that one must or must not be wholly enclosed within another feature\&. Default value: A +.RE +.PP +\fB\-minrange\fR \fIinteger\fR +.RS 4 +If this is greater or equal to \'maxrange\', then no min or max range is specified +.RE +.PP +\fB\-maxrange\fR \fIinteger\fR +.RS 4 +If this is less than or equal to \'minrange\', then no min or max range is specified +.RE +.PP +\fB\-rangetype\fR \fIlist\fR +.RS 4 +This allows you to specify the positions from which the allowed minimum or maximum distance between the features is measured Default value: N +.RE +.PP +\fB\-sense\fR \fIlist\fR +.RS 4 +This allows you to specify the required sense that the two features must be on\&. This is ignored (always \'Any\') when looking at protein sequence features\&. Default value: A +.RE +.PP +\fB\-order\fR \fIlist\fR +.RS 4 +This allows you to specify the required order of the two features\&. The order is measured from the start positions of the features\&. This criterion is always applied despite the specified overlap type required\&. Default value: A +.RE +.SS "Output section" +.PP +\fB\-twoout\fR \fItoggle\fR +.RS 4 +If you set this to be true, then the two features themselves will be written out\&. If it is left as false, then a single feature will be written out covering the two features you found\&. Default value: N +.RE +.PP +\fB\-typeout\fR \fIstring\fR +.RS 4 +If you have specified that the pairs of features that are found should be reported as one feature in the ouput, then you can specify the \'type\' name of the new feature here\&. By default every feature in the feature table is allowed\&. See http://www3\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.ch/txt/userman\&.txt for a list of the Swissprot feature types\&. If you specify an invalid feature type name, then the default name \'misc_feature\' is used\&. Default value: misc_feature +.RE +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +twofeat is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/cusp.1e +++ emboss-6.1.0/debian/manpages/cusp.1e @@ -0,0 +1,61 @@ +'\" t +.\" Title: CUSP +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CUSP" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +cusp \- Create a codon usage table from nucleotide sequence(s) +.SH "SYNOPSIS" +.HP \w'\fBcusp\fR\ 'u +\fBcusp\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBcusp\fR\ 'u +\fBcusp\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBcusp\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Codon usage" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +cusp is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/pepinfo.1e +++ emboss-6.1.0/debian/manpages/pepinfo.1e @@ -0,0 +1,91 @@ +'\" t +.\" Title: PEPINFO +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PEPINFO" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +pepinfo \- Plot amino acid properties of a protein sequence in parallel\&. +.SH "SYNOPSIS" +.HP \w'\fBpepinfo\fR\ 'u +\fBpepinfo\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-aaproperties\ \fR\fB\fIdatafile\fR\fR] [\fB\-aahydropathy\ \fR\fB\fIdatafile\fR\fR] [\fB\-hwindow\ \fR\fB\fIinteger\fR\fR] \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-generalplot\ \fR\fB\fIboolean\fR\fR \fB\-hydropathyplot\ \fR\fB\fIboolean\fR\fR +.HP \w'\fBpepinfo\fR\ 'u +\fBpepinfo\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBpepinfo\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-aaproperties\fR \fIdatafile\fR +.RS 4 +Default value: Eaa_properties\&.dat +.RE +.PP +\fB\-aahydropathy\fR \fIdatafile\fR +.RS 4 +Default value: Eaa_hydropathy\&.dat +.RE +.SS "Additional section" +.PP +\fB\-hwindow\fR \fIinteger\fR +.RS 4 +Default value: 9 +.RE +.SS "Output section" +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-generalplot\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-hydropathyplot\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +pepinfo is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/notab.1e +++ emboss-6.1.0/debian/manpages/notab.1e @@ -0,0 +1,64 @@ +'\" t +.\" Title: NOTAB +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "NOTAB" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +notab \- Replace tabs with spaces in an ASCII text file +.SH "SYNOPSIS" +.HP \w'\fBnotab\fR\ 'u +\fBnotab\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBnotab\fR\ 'u +\fBnotab\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBnotab\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.SS "Required section" +.SS "Additional section" +.SS "Advanced section" +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +notab is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/tfscan.1e +++ emboss-6.1.0/debian/manpages/tfscan.1e @@ -0,0 +1,81 @@ +'\" t +.\" Title: TFSCAN +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "TFSCAN" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +tfscan \- Identify transcription factor binding sites in DNA sequences +.SH "SYNOPSIS" +.HP \w'\fBtfscan\fR\ 'u +\fBtfscan\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-menu\ \fR\fB\fIlist\fR\fR \fB\-custom\ \fR\fB\fIdatafile\fR\fR \fB\-mismatch\ \fR\fB\fIinteger\fR\fR [\fB\-minlength\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBtfscan\fR\ 'u +\fBtfscan\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBtfscan\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Transcription" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-menu\fR \fIlist\fR +.RS 4 +Default value: V +.RE +.PP +\fB\-custom\fR \fIdatafile\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-mismatch\fR \fIinteger\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-minlength\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +tfscan is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/plotcon.1e +++ emboss-6.1.0/debian/manpages/plotcon.1e @@ -0,0 +1,73 @@ +'\" t +.\" Title: PLOTCON +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PLOTCON" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +plotcon \- Plot conservation of a sequence alignment +.SH "SYNOPSIS" +.HP \w'\fBplotcon\fR\ 'u +\fBplotcon\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR [\fB\-scorefile\ \fR\fB\fImatrix\fR\fR] \fB\-winsize\ \fR\fB\fIinteger\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR +.HP \w'\fBplotcon\fR\ 'u +\fBplotcon\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBplotcon\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Multiple" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequences\fR \fIseqset\fR +.RS 4 +File containing a sequence alignment +.RE +.PP +\fB\-scorefile\fR \fImatrix\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.SS "Required section" +.PP +\fB\-winsize\fR \fIinteger\fR +.RS 4 +Number of columns to average alignment quality over\&. The larger this value is, the smoother the plot will be\&. Default value: 4 +.RE +.SS "Output section" +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +plotcon is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/wordcount.1e +++ emboss-6.1.0/debian/manpages/wordcount.1e @@ -0,0 +1,73 @@ +'\" t +.\" Title: WORDCOUNT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "WORDCOUNT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +wordcount \- Count and extract unique words in DNA sequence(s) +.SH "SYNOPSIS" +.HP \w'\fBwordcount\fR\ 'u +\fBwordcount\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR [\fB\-mincount\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBwordcount\fR\ 'u +\fBwordcount\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBwordcount\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Composition,Protein:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-wordsize\fR \fIinteger\fR +.RS 4 +Default value: @($(acdprotein)? 2 : 4) +.RE +.SS "Additional section" +.PP +\fB\-mincount\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +wordcount is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/testplot.1e +++ emboss-6.1.0/debian/manpages/testplot.1e @@ -0,0 +1,67 @@ +'\" t +.\" Title: TESTPLOT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "TESTPLOT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +testplot \- Test plot +.SH "SYNOPSIS" +.HP \w'\fBtestplot\fR\ 'u +\fBtestplot\fR \fB\-points\ \fR\fB\fIinteger\fR\fR \fB\-overlap\ \fR\fB\fIboolean\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR +.HP \w'\fBtestplot\fR\ 'u +\fBtestplot\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBtestplot\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Required section" +.PP +\fB\-points\fR \fIinteger\fR +.RS 4 +Default value: 90 +.RE +.SS "Output section" +.PP +\fB\-overlap\fR \fIboolean\fR +.RS 4 +Default value: y +.RE +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +testplot is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/backtranambig.1e +++ emboss-6.1.0/debian/manpages/backtranambig.1e @@ -0,0 +1,66 @@ +'\" t +.\" Title: BACKTRANAMBIG +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "BACKTRANAMBIG" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +backtranambig \- Back\-translate a protein sequence to ambiguous nucleotide sequence +.SH "SYNOPSIS" +.HP \w'\fBbacktranambig\fR\ 'u +\fBbacktranambig\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-table\ \fR\fB\fIlist\fR\fR] \fB\-outfile\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBbacktranambig\fR\ 'u +\fBbacktranambig\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBbacktranambig\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Translation,Protein:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-table\fR \fIlist\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +backtranambig is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/cutseq.1e +++ emboss-6.1.0/debian/manpages/cutseq.1e @@ -0,0 +1,72 @@ +'\" t +.\" Title: CUTSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CUTSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +cutseq \- Removes a section from a sequence +.SH "SYNOPSIS" +.HP \w'\fBcutseq\fR\ 'u +\fBcutseq\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-from\ \fR\fB\fIinteger\fR\fR \fB\-to\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR +.HP \w'\fBcutseq\fR\ 'u +\fBcutseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBcutseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-from\fR \fIinteger\fR +.RS 4 +This is the start position (inclusive) of the section of the sequence that you wish to remove\&. Default value: $(sequence\&.begin) +.RE +.PP +\fB\-to\fR \fIinteger\fR +.RS 4 +This is the end position (inclusive) of the section of the sequence that you wish to remove\&. Default value: $(sequence\&.end) +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +cutseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/extractalign.1e +++ emboss-6.1.0/debian/manpages/extractalign.1e @@ -0,0 +1,67 @@ +'\" t +.\" Title: EXTRACTALIGN +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "EXTRACTALIGN" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +extractalign \- Extract regions from a sequence alignment +.SH "SYNOPSIS" +.HP \w'\fBextractalign\fR\ 'u +\fBextractalign\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR \fB\-regions\ \fR\fB\fIrange\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBextractalign\fR\ 'u +\fBextractalign\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBextractalign\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqset\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-regions\fR \fIrange\fR +.RS 4 +Regions to extract\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are separated by any non\-digit, non\-alpha character\&. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765\&.\&.888 1,5,8,10,23,45,57,99 Default value: $(sequence\&.begin)\-$(sequence\&.end) +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +extractalign is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/aaindexextract.1e +++ emboss-6.1.0/debian/manpages/aaindexextract.1e @@ -0,0 +1,56 @@ +'\" t +.\" Title: AAINDEXEXTRACT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "AAINDEXEXTRACT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +aaindexextract \- Extract amino acid property data from AAINDEX +.SH "SYNOPSIS" +.HP \w'\fBaaindexextract\fR\ 'u +\fBaaindexextract\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR +.HP \w'\fBaaindexextract\fR\ 'u +\fBaaindexextract\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBaaindexextract\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database creation" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +aaindexextract is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/maskfeat.1e +++ emboss-6.1.0/debian/manpages/maskfeat.1e @@ -0,0 +1,77 @@ +'\" t +.\" Title: MASKFEAT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "MASKFEAT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +maskfeat \- Write a sequence with masked features +.SH "SYNOPSIS" +.HP \w'\fBmaskfeat\fR\ 'u +\fBmaskfeat\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-type\ \fR\fB\fIstring\fR\fR] [\fB\-tolower\ \fR\fB\fItoggle\fR\fR] \fB\-maskchar\ \fR\fB\fIstring\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR +.HP \w'\fBmaskfeat\fR\ 'u +\fBmaskfeat\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBmaskfeat\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit,Feature tables" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-type\fR \fIstring\fR +.RS 4 +By default any feature in the feature table with a type starting \'repeat\' is masked\&. You can set this to be any feature type you wish to mask\&. See http://www3\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.ch/txt/userman\&.txt for a list of the Swissprot feature types\&. The type may be wildcarded by using \'*\'\&. If you wish to mask more than one type, separate their names with spaces or commas, eg: *UTR repeat* Default value: repeat* +.RE +.PP +\fB\-tolower\fR \fItoggle\fR +.RS 4 +The region can be \'masked\' by converting the sequence characters to lower\-case, some non\-EMBOSS programs e\&.g\&. fasta can interpret this as a masked region\&. The sequence is unchanged apart from the case change\&. You might like to ensure that the whole sequence is in upper\-case before masking the specified regions to lower\-case by using the \'\-supper\' flag\&. Default value: N +.RE +.PP +\fB\-maskchar\fR \fIstring\fR +.RS 4 +Character to use when masking\&. Default is \'X\' for protein sequences, \'N\' for nucleic sequences\&. If the mask character is set to be the SPACE character or a null character, then the sequence is \'masked\' by changing it to lower\-case, just as with the \'\-lowercase\' flag\&. Default value: @($(acdprotein)?X:N) +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +maskfeat is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/fuzztran.1e +++ emboss-6.1.0/debian/manpages/fuzztran.1e @@ -0,0 +1,76 @@ +'\" t +.\" Title: FUZZTRAN +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "FUZZTRAN" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +fuzztran \- Search for patterns in protein sequences (translated) +.SH "SYNOPSIS" +.HP \w'\fBfuzztran\fR\ 'u +\fBfuzztran\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-pattern\ \fR\fB\fIpattern\fR\fR [\fB\-frame\ \fR\fB\fIlist\fR\fR] [\fB\-table\ \fR\fB\fIlist\fR\fR] \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBfuzztran\fR\ 'u +\fBfuzztran\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBfuzztran\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Motifs,Protein:Motifs" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-pattern\fR \fIpattern\fR +.RS 4 +The standard IUPAC one\-letter codes for the amino acids are used\&. The symbol \'x\' is used for a position where any amino acid is accepted\&. Ambiguities are indicated by listing the acceptable amino acids for a given position, between square parentheses \'[ ]\'\&. For example: [ALT] stands for Ala or Leu or Thr\&. Ambiguities are also indicated by listing between a pair of curly brackets \'{ }\' the amino acids that are not accepted at a gven position\&. For example: {AM} stands for any amino acid except Ala and Met\&. Each element in a pattern is separated from its neighbor by a \'\-\'\&. (Optional in fuzztran) Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis\&. Examples: x(3) corresponds to x\-x\-x, x(2,4) corresponds to x\-x or x\-x\-x or x\-x\-x\-x\&. When a pattern is restricted to either the N\- or C\-terminal of a sequence, that pattern either starts with a \'<\' symbol or respectively ends with a \'>\' symbol\&. A period ends the pattern\&. (Optional in fuzztran)\&. For example, [DE](2)HS{P}X(2)PX(2,4)C +.RE +.SS "Additional section" +.PP +\fB\-frame\fR \fIlist\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-table\fR \fIlist\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +fuzztran is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/getorf.1e +++ emboss-6.1.0/debian/manpages/getorf.1e @@ -0,0 +1,102 @@ +'\" t +.\" Title: GETORF +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "GETORF" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +getorf \- Finds and extracts open reading frames (ORFs) +.SH "SYNOPSIS" +.HP \w'\fBgetorf\fR\ 'u +\fBgetorf\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-table\ \fR\fB\fIlist\fR\fR] [\fB\-minsize\ \fR\fB\fIinteger\fR\fR] [\fB\-maxsize\ \fR\fB\fIinteger\fR\fR] [\fB\-find\ \fR\fB\fIlist\fR\fR] \fB\-methionine\ \fR\fB\fIboolean\fR\fR \fB\-circular\ \fR\fB\fIboolean\fR\fR \fB\-reverse\ \fR\fB\fIboolean\fR\fR \fB\-flanking\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBgetorf\fR\ 'u +\fBgetorf\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBgetorf\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Gene finding" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-table\fR \fIlist\fR +.RS 4 +.RE +.PP +\fB\-minsize\fR \fIinteger\fR +.RS 4 +Default value: 30 +.RE +.PP +\fB\-maxsize\fR \fIinteger\fR +.RS 4 +Default value: 1000000 +.RE +.PP +\fB\-find\fR \fIlist\fR +.RS 4 +This is a small menu of possible output options\&. The first four options are to select either the protein translation or the original nucleic acid sequence of the open reading frame\&. There are two possible definitions of an open reading frame: it can either be a region that is free of STOP codons or a region that begins with a START codon and ends with a STOP codon\&. The last three options are probably only of interest to people who wish to investigate the statistical properties of the regions around potential START or STOP codons\&. The last option assumes that ORF lengths are calculated between two STOP codons\&. +.RE +.SS "Advanced section" +.PP +\fB\-methionine\fR \fIboolean\fR +.RS 4 +START codons at the beginning of protein products will usually code for Methionine, despite what the codon will code for when it is internal to a protein\&. This qualifier sets all such START codons to code for Methionine by default\&. Default value: Y +.RE +.PP +\fB\-circular\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-reverse\fR \fIboolean\fR +.RS 4 +Set this to be false if you do not wish to find ORFs in the reverse complement of the sequence\&. Default value: Y +.RE +.PP +\fB\-flanking\fR \fIinteger\fR +.RS 4 +If you have chosen one of the options of the type of sequence to find that gives the flanking sequence around a STOP or START codon, this allows you to set the number of nucleotides either side of that codon to output\&. If the region of flanking nucleotides crosses the start or end of the sequence, no output is given for this codon\&. Default value: 100 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +getorf is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/dbxfasta.1e +++ emboss-6.1.0/debian/manpages/dbxfasta.1e @@ -0,0 +1,106 @@ +'\" t +.\" Title: DBXFASTA +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DBXFASTA" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +dbxfasta \- Index a fasta file database using b+tree indices +.SH "SYNOPSIS" +.HP \w'\fBdbxfasta\fR\ 'u +\fBdbxfasta\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBdbxfasta\fR\ 'u +\fBdbxfasta\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdbxfasta\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database indexing" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-dbname\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-dbresource\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-idformat\fR \fIlist\fR +.RS 4 +Default value: idacc +.RE +.PP +\fB\-directory\fR \fIdirectory\fR +.RS 4 +Default value: \&. +.RE +.PP +\fB\-filenames\fR \fIstring\fR +.RS 4 +Default value: *\&.fasta +.RE +.SS "Required section" +.PP +\fB\-fields\fR \fIlist\fR +.RS 4 +Default value: id,acc +.RE +.SS "Advanced section" +.PP +\fB\-release\fR \fIstring\fR +.RS 4 +Default value: 0\&.0 +.RE +.PP +\fB\-date\fR \fIstring\fR +.RS 4 +Default value: 00/00/00 +.RE +.PP +\fB\-exclude\fR \fIstring\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-indexoutdir\fR \fIoutdir\fR +.RS 4 +Default value: \&. +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +dbxfasta is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/yank.1e +++ emboss-6.1.0/debian/manpages/yank.1e @@ -0,0 +1,66 @@ +'\" t +.\" Title: YANK +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "YANK" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +yank \- Add a sequence reference (a full USA) to a list file +.SH "SYNOPSIS" +.HP \w'\fByank\fR\ 'u +\fByank\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-newfile\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fByank\fR\ 'u +\fByank\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fByank\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-newfile\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +yank is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/pepstats.1e +++ emboss-6.1.0/debian/manpages/pepstats.1e @@ -0,0 +1,82 @@ +'\" t +.\" Title: PEPSTATS +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PEPSTATS" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +pepstats \- Calculates statistics of protein properties +.SH "SYNOPSIS" +.HP \w'\fBpepstats\fR\ 'u +\fBpepstats\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-aadata\ \fR\fB\fIdatafile\fR\fR \fB\-mwdata\ \fR\fB\fIdatafile\fR\fR \fB\-termini\ \fR\fB\fIboolean\fR\fR \fB\-mono\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBpepstats\fR\ 'u +\fBpepstats\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBpepstats\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-aadata\fR \fIdatafile\fR +.RS 4 +Amino acid properties Default value: Eamino\&.dat +.RE +.PP +\fB\-mwdata\fR \fIdatafile\fR +.RS 4 +Molecular weight data for amino acids Default value: Emolwt\&.dat +.RE +.SS "Advanced section" +.PP +\fB\-termini\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-mono\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +pepstats is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/shuffleseq.1e +++ emboss-6.1.0/debian/manpages/shuffleseq.1e @@ -0,0 +1,67 @@ +'\" t +.\" Title: SHUFFLESEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SHUFFLESEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +shuffleseq \- Shuffles a set of sequences maintaining composition +.SH "SYNOPSIS" +.HP \w'\fBshuffleseq\fR\ 'u +\fBshuffleseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-shuffle\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBshuffleseq\fR\ 'u +\fBshuffleseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBshuffleseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Mutation,Protein:Mutation" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-shuffle\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +shuffleseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/origsplitter.1e +++ emboss-6.1.0/debian/manpages/origsplitter.1e @@ -0,0 +1,77 @@ +'\" t +.\" Title: ORIGSPLITTER +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ORIGSPLITTER" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +origsplitter \- Split a sequence into (overlapping) smaller sequences +.SH "SYNOPSIS" +.HP \w'\fBorigsplitter\fR\ 'u +\fBorigsplitter\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-size\ \fR\fB\fIinteger\fR\fR] [\fB\-overlap\ \fR\fB\fIinteger\fR\fR] \fB\-addoverlap\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBorigsplitter\fR\ 'u +\fBorigsplitter\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBorigsplitter\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-size\fR \fIinteger\fR +.RS 4 +Default value: 10000 +.RE +.PP +\fB\-overlap\fR \fIinteger\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-addoverlap\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +origsplitter is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/eprimer3.1e +++ emboss-6.1.0/debian/manpages/eprimer3.1e @@ -0,0 +1,356 @@ +'\" t +.\" Title: EPRIMER3 +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "EPRIMER3" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +eprimer3 \- Picks PCR primers and hybridization oligos +.SH "SYNOPSIS" +.HP \w'\fBeprimer3\fR\ 'u +\fBeprimer3\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-primer\ \fR\fB\fItoggle\fR\fR] \fB\-task\ \fR\fB\fIlist\fR\fR [\fB\-hybridprobe\ \fR\fB\fItoggle\fR\fR] \fB\-mishyblibraryfile\ \fR\fB\fIinfile\fR\fR \fB\-mispriminglibraryfile\ \fR\fB\fIinfile\fR\fR [\fB\-numreturn\ \fR\fB\fIinteger\fR\fR] [\fB\-includedregion\ \fR\fB\fIrange\fR\fR] [\fB\-target\ \fR\fB\fIrange\fR\fR] [\fB\-excludedregion\ \fR\fB\fIrange\fR\fR] [\fB\-forwardinput\ \fR\fB\fIstring\fR\fR] [\fB\-reverseinput\ \fR\fB\fIstring\fR\fR] \fB\-gcclamp\ \fR\fB\fIinteger\fR\fR \fB\-osize\ \fR\fB\fIinteger\fR\fR \fB\-minsize\ \fR\fB\fIinteger\fR\fR \fB\-maxsize\ \fR\fB\fIinteger\fR\fR \fB\-otm\ \fR\fB\fIfloat\fR\fR \fB\-mintm\ \fR\fB\fIfloat\fR\fR \fB\-maxtm\ \fR\fB\fIfloat\fR\fR \fB\-maxdifftm\ \fR\fB\fIfloat\fR\fR \fB\-ogcpercent\ \fR\fB\fIfloat\fR\fR \fB\-mingc\ \fR\fB\fIfloat\fR\fR \fB\-maxgc\ \fR\fB\fIfloat\fR\fR \fB\-saltconc\ \fR\fB\fIfloat\fR\fR \fB\-dnaconc\ \fR\fB\fIfloat\fR\fR \fB\-maxpolyx\ \fR\fB\fIinteger\fR\fR \fB\-psizeopt\ \fR\fB\fIinteger\fR\fR \fB\-prange\ \fR\fB\fIrange\fR\fR \fB\-ptmopt\ \fR\fB\fIfloat\fR\fR \fB\-ptmmin\ \fR\fB\fIfloat\fR\fR \fB\-ptmmax\ \fR\fB\fIfloat\fR\fR \fB\-oexcludedregion\ \fR\fB\fIrange\fR\fR \fB\-oligoinput\ \fR\fB\fIstring\fR\fR \fB\-osizeopt\ \fR\fB\fIinteger\fR\fR \fB\-ominsize\ \fR\fB\fIinteger\fR\fR \fB\-omaxsize\ \fR\fB\fIinteger\fR\fR \fB\-otmopt\ \fR\fB\fIfloat\fR\fR \fB\-otmmin\ \fR\fB\fIfloat\fR\fR \fB\-otmmax\ \fR\fB\fIfloat\fR\fR \fB\-ogcopt\ \fR\fB\fIfloat\fR\fR \fB\-ogcmin\ \fR\fB\fIfloat\fR\fR \fB\-ogcmax\ \fR\fB\fIfloat\fR\fR \fB\-osaltconc\ \fR\fB\fIfloat\fR\fR \fB\-odnaconc\ \fR\fB\fIfloat\fR\fR \fB\-oanyself\ \fR\fB\fIfloat\fR\fR \fB\-oendself\ \fR\fB\fIfloat\fR\fR \fB\-opolyxmax\ \fR\fB\fIinteger\fR\fR \fB\-omishybmax\ \fR\fB\fIfloat\fR\fR \fB\-explainflag\ \fR\fB\fIboolean\fR\fR \fB\-fileflag\ \fR\fB\fIboolean\fR\fR \fB\-firstbaseindex\ \fR\fB\fIinteger\fR\fR \fB\-pickanyway\ \fR\fB\fIboolean\fR\fR \fB\-maxmispriming\ \fR\fB\fIfloat\fR\fR \fB\-pairmaxmispriming\ \fR\fB\fIfloat\fR\fR \fB\-numnsaccepted\ \fR\fB\fIinteger\fR\fR \fB\-selfany\ \fR\fB\fIfloat\fR\fR \fB\-selfend\ \fR\fB\fIfloat\fR\fR \fB\-maxendstability\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBeprimer3\fR\ 'u +\fBeprimer3\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBeprimer3\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Primers" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +The sequence from which to choose primers\&. The sequence must be presented 5\' to 3\' +.RE +.PP +\fB\-primer\fR \fItoggle\fR +.RS 4 +Tell EPrimer3 to pick primer(s) Default value: Y +.RE +.PP +\fB\-task\fR \fIlist\fR +.RS 4 +Tell EPrimer3 what task to perform\&. Legal values are 1: \'Pick PCR primers\', 2: \'Pick forward primer only\', 3: \'Pick reverse primer only\', 4: \'No primers needed\'\&. Default value: 1 +.RE +.PP +\fB\-hybridprobe\fR \fItoggle\fR +.RS 4 +An \'internal oligo\' is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification\&. Default value: N +.RE +.PP +\fB\-mishyblibraryfile\fR \fIinfile\fR +.RS 4 +Similar to MISPRIMING\-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather than priming from them\&. The file must be in (a slightly restricted) FASTA format (W\&. B\&. Pearson and D\&.J\&. Lipman, PNAS 85:8 pp 2444\-2448 [1988]); we briefly discuss the organization of this file below\&. If this parameter is specified then EPrimer3 locally aligns each candidate oligo against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds INTERNAL\-OLIGO\-MAX\-MISHYB\&. (The maximum value of the weight is arbitrarily set to 12\&.0\&.) Each sequence entry in the FASTA\-format file must begin with an \'id line\' that starts with \'>\'\&. The contents of the id line is \'slightly restricted\' in that EPrimer3 parses everything after any optional asterisk (\'*\') as a floating point number to use as the weight mentioned above\&. If the id line contains no asterisk then the weight defaults to 1\&.0\&. The alignment scoring system used is the same as for calculating complementarity among oligos (e\&.g\&. SELF\-ANY)\&. The remainder of an entry contains the sequence as lines following the id line up until a line starting with \'>\' or the end of the file\&. Whitespace and newlines are ignored\&. Characters \'A\', \'T\', \'G\', \'C\', \'a\', \'t\', \'g\', \'c\' are retained and any other character is converted to \'N\' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to \'N\')\&. There are no restrictions on line length\&. An empty value for this parameter indicates that no library should be used\&. +.RE +.PP +\fB\-mispriminglibraryfile\fR \fIinfile\fR +.RS 4 +The name of a file containing a nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified\&.) The file must be in (a slightly restricted) FASTA format (W\&. B\&. Pearson and D\&.J\&. Lipman, PNAS 85:8 pp 2444\-2448 [1988]); we briefly discuss the organization of this file below\&. If this parameter is specified then EPrimer3 locally aligns each candidate primer against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds MAX\-MISPRIMING\&. (The maximum value of the weight is arbitrarily set to 100\&.0\&.) Each sequence entry in the FASTA\-format file must begin with an \'id line\' that starts with \'>\'\&. The contents of the id line is \'slightly restricted\' in that EPrimer3 parses everything after any optional asterisk (\'*\') as a floating point number to use as the weight mentioned above\&. If the id line contains no asterisk then the weight defaults to 1\&.0\&. The alignment scoring system used is the same as for calculating complementarity among oligos (e\&.g\&. SELF\-ANY)\&. The remainder of an entry contains the sequence as lines following the id line up until a line starting with \'>\' or the end of the file\&. Whitespace and newlines are ignored\&. Characters \'A\', \'T\', \'G\', \'C\', \'a\', \'t\', \'g\', \'c\' are retained and any other character is converted to \'N\' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to \'N\')\&. There are no restrictions on line length\&. An empty value for this parameter indicates that no repeat library should be used\&. +.RE +.SS "Additional section" +.SS "Program options" +.PP +\fB\-numreturn\fR \fIinteger\fR +.RS 4 +The maximum number of primer pairs to return\&. Primer pairs returned are sorted by their \'quality\', in other words by the value of the objective function (where a lower number indicates a better primer pair)\&. Caution: setting this parameter to a large value will increase running time\&. Default value: 5 +.RE +.SS "Sequence options" +.PP +\fB\-includedregion\fR \fIrange\fR +.RS 4 +A sub\-region of the given sequence in which to pick primers\&. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration\&. The value for this parameter has the form (start),(end) where (start) is the index of the first base to consider, and (end) is the last in the primer\-picking region\&. +.RE +.PP +\fB\-target\fR \fIrange\fR +.RS 4 +If one or more Targets is specified then a legal primer pair must flank at least one of them\&. A Target might be a simple sequence repeat site (for example a CA repeat) or a single\-base\-pair polymorphism\&. The value should be a space\-separated list of (start),(end) pairs where (start) is the index of the first base of a Target, and (end) is the last E\&.g\&. 50,51 requires primers to surround the 2 bases at positions 50 and 51\&. +.RE +.PP +\fB\-excludedregion\fR \fIrange\fR +.RS 4 +Primer oligos may not overlap any region specified in this tag\&. The associated value must be a space\-separated list of (start),(end) pairs where (start) is the index of the first base of the excluded region, and and (end) is the last\&. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs\&. E\&.g\&. 401,407 68,70 forbids selection of primers in the 7 bases starting at 401 and the 3 bases at 68\&. +.RE +.PP +\fB\-forwardinput\fR \fIstring\fR +.RS 4 +The sequence of a forward primer to check and around which to design reverse primers and optional internal oligos\&. Must be a substring of SEQUENCE\&. +.RE +.PP +\fB\-reverseinput\fR \fIstring\fR +.RS 4 +The sequence of a reverse primer to check and around which to design forward primers and optional internal oligos\&. Must be a substring of the reverse strand of SEQUENCE\&. +.RE +.SS "Primer options" +.PP +\fB\-gcclamp\fR \fIinteger\fR +.RS 4 +Require the specified number of consecutive Gs and Cs at the 3\' end of both the forward and reverse primer\&. (This parameter has no effect on the internal oligo if one is requested\&.) +.RE +.PP +\fB\-osize\fR \fIinteger\fR +.RS 4 +Optimum length (in bases) of a primer oligo\&. EPrimer3 will attempt to pick primers close to this length\&. Default value: 20 +.RE +.PP +\fB\-minsize\fR \fIinteger\fR +.RS 4 +Minimum acceptable length of a primer\&. Must be greater than 0 and less than or equal to MAX\-SIZE\&. Default value: 18 +.RE +.PP +\fB\-maxsize\fR \fIinteger\fR +.RS 4 +Maximum acceptable length (in bases) of a primer\&. Currently this parameter cannot be larger than 35\&. This limit is governed by the maximum oligo size for which EPrimer3\'s melting\-temperature is valid\&. Default value: 27 +.RE +.PP +\fB\-otm\fR \fIfloat\fR +.RS 4 +Optimum melting temperature(Celsius) for a primer oligo\&. EPrimer3 will try to pick primers with melting temperatures are close to this temperature\&. The oligo melting temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 21, pp 6409\-6412 and Breslauer, Frank, Bloecker and Marky, Proc\&. Natl\&. Acad\&. Sci\&. USA, vol 83, pp 3746\-3750\&. Please refer to the former paper for background discussion\&. Default value: 60\&.0 +.RE +.PP +\fB\-mintm\fR \fIfloat\fR +.RS 4 +Minimum acceptable melting temperature(Celsius) for a primer oligo\&. Default value: 57\&.0 +.RE +.PP +\fB\-maxtm\fR \fIfloat\fR +.RS 4 +Maximum acceptable melting temperature(Celsius) for a primer oligo\&. Default value: 63\&.0 +.RE +.PP +\fB\-maxdifftm\fR \fIfloat\fR +.RS 4 +Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers\&. Default value: 100\&.0 +.RE +.PP +\fB\-ogcpercent\fR \fIfloat\fR +.RS 4 +Primer optimum GC percent\&. Default value: 50\&.0 +.RE +.PP +\fB\-mingc\fR \fIfloat\fR +.RS 4 +Minimum allowable percentage of Gs and Cs in any primer\&. Default value: 20\&.0 +.RE +.PP +\fB\-maxgc\fR \fIfloat\fR +.RS 4 +Maximum allowable percentage of Gs and Cs in any primer generated by Primer\&. Default value: 80\&.0 +.RE +.PP +\fB\-saltconc\fR \fIfloat\fR +.RS 4 +The millimolar concentration of salt (usually KCl) in the PCR\&. EPrimer3 uses this argument to calculate oligo melting temperatures\&. Default value: 50\&.0 +.RE +.PP +\fB\-dnaconc\fR \fIfloat\fR +.RS 4 +The nanomolar concentration of annealing oligos in the PCR\&. EPrimer3 uses this argument to calculate oligo melting temperatures\&. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research\-\-0\&.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0\&.025 units/microliter Taq polymerase in 0\&.1 mM each dNTP, 1\&.5mM MgCl2, 50mM KCl, 10mM Tris\-HCL (pH 9\&.3) using 35 cycles with an annealing temperature of 56 degrees Celsius\&. This parameter corresponds to \'c\' in Rychlik, Spencer and Rhoads\' equation (ii) (Nucleic Acids Research, vol 18, num 21) where a suitable value (for a lower initial concentration of template) is \'empirically determined\'\&. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle\&. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures\&. See ADVICE FOR PICKING PRIMERS\&. Default value: 50\&.0 +.RE +.PP +\fB\-maxpolyx\fR \fIinteger\fR +.RS 4 +The maximum allowable length of a mononucleotide repeat in a primer, for example AAAAAA\&. Default value: 5 +.RE +.SS "Product options" +.PP +\fB\-psizeopt\fR \fIinteger\fR +.RS 4 +The optimum size for the PCR product\&. 0 indicates that there is no optimum product size\&. Default value: 200 +.RE +.PP +\fB\-prange\fR \fIrange\fR +.RS 4 +The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form (x)\-(y) where an (x)\-(y) pair is a legal range of lengths for the product\&. For example, if one wants PCR products to be between 100 to 150 bases (inclusive) then one would set this parameter to 100\-150\&. If one desires PCR products in either the range from 100 to 150 bases or in the range from 200 to 250 bases then one would set this parameter to 100\-150 200\-250\&. EPrimer3 favors ranges to the left side of the parameter string\&. EPrimer3 will return legal primers pairs in the first range regardless the value of the objective function for these pairs\&. Only if there are an insufficient number of primers in the first range will EPrimer3 return primers in a subsequent range\&. Default value: 100\-300 +.RE +.PP +\fB\-ptmopt\fR \fIfloat\fR +.RS 4 +The optimum melting temperature for the PCR product\&. 0 indicates that there is no optimum temperature\&. Default value: 0\&.0 +.RE +.PP +\fB\-ptmmin\fR \fIfloat\fR +.RS 4 +The minimum allowed melting temperature of the amplicon\&. Please see the documentation on the maximum melting temperature of the product for details\&. Default value: \-1000000\&.0 +.RE +.PP +\fB\-ptmmax\fR \fIfloat\fR +.RS 4 +The maximum allowed melting temperature of the amplicon\&. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11\&.46 (1989, CSHL Press)\&. Tm = 81\&.5 + 16\&.6(log10([Na+])) + \&.41*(%GC) \- 600/length Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence\&. A similar formula is used by the prime primer selection program in GCG http://www\&.gcg\&.com), which instead uses 675\&.0/length in the last term (after F\&. Baldino, Jr, M\&.\-F\&. Chesselet, and M\&.E\&. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms)\&. The formulas here and in Baldino et al\&. assume Na+ rather than K+\&. According to J\&.G\&. Wetmur, Critical Reviews in BioChem\&. and Mol\&. Bio\&. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to \&.2 M Na+\&. EPrimer3 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature\&. If you are planning to use the PCR product for hybridization later this behavior will not give you the Tm under hybridization conditions\&. Default value: 1000000\&.0 +.RE +.SS "Internal oligo input" +.PP +\fB\-oexcludedregion\fR \fIrange\fR +.RS 4 +Middle oligos may not overlap any region specified by this tag\&. The associated value must be a space\-separated list of (start),(end) pairs, where (start) is the index of the first base of an excluded region, and (end) is the last\&. Often one would make Target regions excluded regions for internal oligos\&. +.RE +.PP +\fB\-oligoinput\fR \fIstring\fR +.RS 4 +The sequence of an internal oligo to check and around which to design forward and reverse primers\&. Must be a substring of SEQUENCE\&. +.RE +.SS "Internal oligo options" +.PP +\fB\-osizeopt\fR \fIinteger\fR +.RS 4 +Optimum length (in bases) of an internal oligo\&. EPrimer3 will attempt to pick primers close to this length\&. Default value: 20 +.RE +.PP +\fB\-ominsize\fR \fIinteger\fR +.RS 4 +Minimum acceptable length of an internal oligo\&. Must be greater than 0 and less than or equal to INTERNAL\-OLIGO\-MAX\-SIZE\&. Default value: 18 +.RE +.PP +\fB\-omaxsize\fR \fIinteger\fR +.RS 4 +Maximum acceptable length (in bases) of an internal oligo\&. Currently this parameter cannot be larger than 35\&. This limit is governed by maximum oligo size for which EPrimer3\'s melting\-temperature is valid\&. Default value: 27 +.RE +.PP +\fB\-otmopt\fR \fIfloat\fR +.RS 4 +Optimum melting temperature (Celsius) for an internal oligo\&. EPrimer3 will try to pick oligos with melting temperatures that are close to this temperature\&. The oligo melting temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 21, pp 6409\-6412 and Breslauer, Frank, Bloecker and Marky, Proc\&. Natl\&. Acad\&. Sci\&. USA, vol 83, pp 3746\-3750\&. Please refer to the former paper for background discussion\&. Default value: 60\&.0 +.RE +.PP +\fB\-otmmin\fR \fIfloat\fR +.RS 4 +Minimum acceptable melting temperature(Celsius) for an internal oligo\&. Default value: 57\&.0 +.RE +.PP +\fB\-otmmax\fR \fIfloat\fR +.RS 4 +Maximum acceptable melting temperature (Celsius) for an internal oligo\&. Default value: 63\&.0 +.RE +.PP +\fB\-ogcopt\fR \fIfloat\fR +.RS 4 +Internal oligo optimum GC percent\&. Default value: 50\&.0 +.RE +.PP +\fB\-ogcmin\fR \fIfloat\fR +.RS 4 +Minimum allowable percentage of Gs and Cs in an internal oligo\&. Default value: 20\&.0 +.RE +.PP +\fB\-ogcmax\fR \fIfloat\fR +.RS 4 +Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer\&. Default value: 80\&.0 +.RE +.PP +\fB\-osaltconc\fR \fIfloat\fR +.RS 4 +The millimolar concentration of salt (usually KCl) in the hybridization\&. EPrimer3 uses this argument to calculate internal oligo melting temperatures\&. Default value: 50\&.0 +.RE +.PP +\fB\-odnaconc\fR \fIfloat\fR +.RS 4 +The nanomolar concentration of annealing internal oligo in the hybridization\&. Default value: 50\&.0 +.RE +.PP +\fB\-oanyself\fR \fIfloat\fR +.RS 4 +The maximum allowable local alignment score when testing an internal oligo for (local) self\-complementarity\&. Local self\-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1\&.00 for complementary bases, \-0\&.25 for a match of any base (or N) with an N, \-1\&.00 for a mismatch, and \-2\&.00 for a gap\&. Only single\-base\-pair gaps are allowed\&. For example, the alignment 5\' ATCGNA 3\' || | | 3\' TA\-CGT 5\' is allowed (and yields a score of 1\&.75), but the alignment 5\' ATCCGNA 3\' || | | 3\' TA\-\-CGT 5\' is not considered\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable local alignment between two oligos\&. Default value: 12\&.00 +.RE +.PP +\fB\-oendself\fR \fIfloat\fR +.RS 4 +The maximum allowable 3\'\-anchored global alignment score when testing a single oligo for self\-complementarity\&. The scoring system is as for the Maximum Complementarity argument\&. In the examples above the scores are 7\&.00 and 6\&.00 respectively\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable 3\'\-anchored global alignment between two oligos\&. In order to estimate 3\'\-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5\' to 3\'\&. INTERNAL\-OLIGO\-SELF\-END is meaningless when applied to internal oligos used for hybridization\-based detection, since primer\-dimer will not occur\&. We recommend that INTERNAL\-OLIGO\-SELF\-END be set at least as high as INTERNAL\-OLIGO\-SELF\-ANY\&. Default value: 12\&.00 +.RE +.PP +\fB\-opolyxmax\fR \fIinteger\fR +.RS 4 +The maximum allowable length of an internal oligo mononucleotide repeat, for example AAAAAA\&. Default value: 5 +.RE +.PP +\fB\-omishybmax\fR \fIfloat\fR +.RS 4 +Similar to MAX\-MISPRIMING except that this parameter applies to the similarity of candidate internal oligos to the library specified in INTERNAL\-OLIGO\-MISHYB\-LIBRARY\&. Default value: 12\&.0 +.RE +.SS "Advanced section" +.PP +\fB\-explainflag\fR \fIboolean\fR +.RS 4 +If this flag is true, produce LEFT\-EXPLAIN, RIGHT\-EXPLAIN, and INTERNAL\-OLIGO\-EXPLAIN output tags, which are intended to provide information on the number of oligos and primer pairs that EPrimer3 examined, and statistics on the number discarded for various reasons\&. Default value: N +.RE +.PP +\fB\-fileflag\fR \fIboolean\fR +.RS 4 +If the associated value is true, then EPrimer3 creates two output files for each input SEQUENCE\&. File (sequence\-id)\&.for lists all acceptable forward primers for (sequence\-id), and (sequence\-id)\&.rev lists all acceptable reverse primers for (sequence\-id), where (sequence\-id) is the value of the SEQUENCE\-ID tag (which must be supplied)\&. In addition, if the input tag TASK is 1 or 4, EPrimer3 produces a file (sequence\-id)\&.int, which lists all acceptable internal oligos\&. Default value: N +.RE +.PP +\fB\-firstbaseindex\fR \fIinteger\fR +.RS 4 +This parameter is the index of the first base in the input sequence\&. For input and output using 1\-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1\&. For input and output using 0\-based indexing set this parameter to 0\&. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set\&.) Default value: 1 +.RE +.PP +\fB\-pickanyway\fR \fIboolean\fR +.RS 4 +If true pick a primer pair even if LEFT\-INPUT, RIGHT\-INPUT, or INTERNAL\-OLIGO\-INPUT violates specific constraints\&. Default value: N +.RE +.PP +\fB\-maxmispriming\fR \fIfloat\fR +.RS 4 +The maximum allowed weighted similarity with any sequence in MISPRIMING\-LIBRARY\&. Default value: 12\&.00 +.RE +.PP +\fB\-pairmaxmispriming\fR \fIfloat\fR +.RS 4 +The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING\-LIBRARY\&. Default value: 24\&.00 +.RE +.PP +\fB\-numnsaccepted\fR \fIinteger\fR +.RS 4 +Maximum number of unknown bases (N) allowable in any primer\&. +.RE +.PP +\fB\-selfany\fR \fIfloat\fR +.RS 4 +The maximum allowable local alignment score when testing a single primer for (local) self\-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers\&. Local self\-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self\-priming in the PCR\&. The scoring system gives 1\&.00 for complementary bases, \-0\&.25 for a match of any base (or N) with an N, \-1\&.00 for a mismatch, and \-2\&.00 for a gap\&. Only single\-base\-pair gaps are allowed\&. For example, the alignment 5\' ATCGNA 3\' \&.\&.\&.|| | | 3\' TA\-CGT 5\' is allowed (and yields a score of 1\&.75), but the alignment 5\' ATCCGNA 3\' \&.\&.\&.|| | | 3\' TA\-\-CGT 5\' is not considered\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable local alignment between two oligos\&. Default value: 8\&.00 +.RE +.PP +\fB\-selfend\fR \fIfloat\fR +.RS 4 +The maximum allowable 3\'\-anchored global alignment score when testing a single primer for self\-complementarity, and the maximum allowable 3\'\-anchored global alignment score when testing for complementarity between forward and reverse primers\&. The 3\'\-anchored global alignment score is taken to predict the likelihood of PCR\-priming primer\-dimers, for example 5\' ATGCCCTAGCTTCCGGATG 3\' \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.||| ||||| \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.3\' AAGTCCTACATTTAGCCTAGT 5\' or 5\' AGGCTATGGGCCTCGCGA 3\' \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.|||||| \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.3\' AGCGCTCCGGGTATCGGA 5\' The scoring system is as for the Maximum Complementarity argument\&. In the examples above the scores are 7\&.00 and 6\&.00 respectively\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable 3\'\-anchored global alignment between two oligos\&. In order to estimate 3\'\-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5\' to 3\'\&. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment\&. Default value: 3\&.00 +.RE +.SS "Primer penalty weights" +.PP +\fB\-maxendstability\fR \fIfloat\fR +.RS 4 +The maximum stability for the five 3\' bases of a forward or reverse primer\&. Bigger numbers mean more stable 3\' ends\&. The value is the maximum delta G for duplex disruption for the five 3\' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloecker and Marky, Proc\&. Natl\&. Acad\&. Sci\&. USA, vol 83, pp 3746\-3750\&. EPrimer3 uses a completely permissive default value for backward compatibility (which we may change in the next release)\&. Rychlik recommends a maximum value of 9 (Wojciech Rychlik, \'Selection of Primers for Polymerase Chain Reaction\' in BA White, Ed\&., \'Methods in Molecular Biology, Vol\&. 15: PCR Protocols: Current Methods and Applications\', 1993, pp 31\-40, Humana Press, Totowa NJ)\&. Default value: 9\&.0 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +eprimer3 is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/fuzzpro.1e +++ emboss-6.1.0/debian/manpages/fuzzpro.1e @@ -0,0 +1,66 @@ +'\" t +.\" Title: FUZZPRO +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "FUZZPRO" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +fuzzpro \- Search for patterns in protein sequences +.SH "SYNOPSIS" +.HP \w'\fBfuzzpro\fR\ 'u +\fBfuzzpro\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-pattern\ \fR\fB\fIpattern\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBfuzzpro\fR\ 'u +\fBfuzzpro\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBfuzzpro\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Motifs" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-pattern\fR \fIpattern\fR +.RS 4 +The standard IUPAC one\-letter codes for the amino acids are used\&. The symbol \'x\' is used for a position where any amino acid is accepted\&. Ambiguities are indicated by listing the acceptable amino acids for a given position, between square parentheses \'[ ]\'\&. For example: [ALT] stands for Ala or Leu or Thr\&. Ambiguities are also indicated by listing between a pair of curly brackets \'{ }\' the amino acids that are not accepted at a given position\&. For example: {AM} stands for any amino acid except Ala and Met\&. Each element in a pattern is separated from its neighbor by a \'\-\'\&. (Optional in fuzzpro)\&. Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis\&. Examples: x(3) corresponds to x\-x\-x, x(2,4) corresponds to x\-x or x\-x\-x or x\-x\-x\-x\&. When a pattern is restricted to either the N\- or C\-terminal of a sequence, that pattern either starts with a \'<\' symbol or respectively ends with a \'>\' symbol\&. A period ends the pattern\&. (Optional in fuzzpro)\&. For example, [DE](2)HS{P}X(2)PX(2,4)C +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +fuzzpro is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/infoseq.1e +++ emboss-6.1.0/debian/manpages/infoseq.1e @@ -0,0 +1,138 @@ +'\" t +.\" Title: INFOSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "INFOSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +infoseq \- Display basic information about sequences +.SH "SYNOPSIS" +.HP \w'\fBinfoseq\fR\ 'u +\fBinfoseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-columns\ \fR\fB\fIboolean\fR\fR \fB\-delimiter\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR] \fB\-only\ \fR\fB\fIboolean\fR\fR \fB\-heading\ \fR\fB\fIboolean\fR\fR \fB\-usa\ \fR\fB\fIboolean\fR\fR \fB\-database\ \fR\fB\fIboolean\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-accession\ \fR\fB\fIboolean\fR\fR \fB\-gi\ \fR\fB\fIboolean\fR\fR \fB\-version\ \fR\fB\fIboolean\fR\fR \fB\-type\ \fR\fB\fIboolean\fR\fR \fB\-length\ \fR\fB\fIboolean\fR\fR \fB\-pgc\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR +.HP \w'\fBinfoseq\fR\ 'u +\fBinfoseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBinfoseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-columns\fR \fIboolean\fR +.RS 4 +Set this option on (Y) to print the sequence information into neat, aligned columns in the output file\&. Alternatively, leave it unset (N), in which case the information records will be delimited by a character, which you may specify by using the \-delimiter option\&. In other words, if \-columns is set on, the \-delimiter option is overriden\&. Default value: Y +.RE +.PP +\fB\-delimiter\fR \fIstring\fR +.RS 4 +This string, which is usually a single character only, is used to delimit individual records in the text output file\&. It could be a space character, a tab character, a pipe character or any other character or string\&. Default value: | +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +If you enter the name of a file here then this program will write the sequence details into that file\&. Default value: stdout +.RE +.PP +\fB\-html\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-only\fR \fIboolean\fR +.RS 4 +This is a way of shortening the command line if you only want a few things to be displayed\&. Instead of specifying: \'\-nohead \-noname \-noacc \-notype \-nopgc \-nodesc\' to get only the length output, you can specify \'\-only \-length\' Default value: N +.RE +.PP +\fB\-heading\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-usa\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-database\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-name\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-accession\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-gi\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-version\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-type\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-length\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-pgc\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-description\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +infoseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/merger.1e +++ emboss-6.1.0/debian/manpages/merger.1e @@ -0,0 +1,85 @@ +'\" t +.\" Title: MERGER +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "MERGER" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +merger \- Merge two overlapping sequences +.SH "SYNOPSIS" +.HP \w'\fBmerger\fR\ 'u +\fBmerger\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR [\fB\-datafile\ \fR\fB\fImatrixf\fR\fR] [\fB\-gapopen\ \fR\fB\fIfloat\fR\fR] [\fB\-gapextend\ \fR\fB\fIfloat\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR +.HP \w'\fBmerger\fR\ 'u +\fBmerger\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBmerger\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Consensus" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-asequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-bsequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fImatrixf\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.SS "Additional section" +.PP +\fB\-gapopen\fR \fIfloat\fR +.RS 4 +Default value: @($(acdprotein)? 50\&.0 : 50\&.0 ) +.RE +.PP +\fB\-gapextend\fR \fIfloat\fR +.RS 4 +Default value: @($(acdprotein)? 5\&.0 : 5\&.0) +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIalign\fR +.RS 4 +.RE +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +merger is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/coderet.1e +++ emboss-6.1.0/debian/manpages/coderet.1e @@ -0,0 +1,77 @@ +'\" t +.\" Title: CODERET +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CODERET" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +coderet \- Extract CDS, mRNA and translations from feature tables +.SH "SYNOPSIS" +.HP \w'\fBcoderet\fR\ 'u +\fBcoderet\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-cdsoutseq\ \fR\fB\fIseqoutall\fR\fR \fB\-mrnaoutseq\ \fR\fB\fIseqoutall\fR\fR \fB\-translationoutseq\ \fR\fB\fIseqoutall\fR\fR \fB\-restoutseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBcoderet\fR\ 'u +\fBcoderet\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBcoderet\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Feature tables,Nucleic:Translation" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-seqall\fR \fIseqall\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-cdsoutseq\fR \fIseqoutall\fR +.RS 4 +.RE +.PP +\fB\-mrnaoutseq\fR \fIseqoutall\fR +.RS 4 +.RE +.PP +\fB\-translationoutseq\fR \fIseqoutall\fR +.RS 4 +.RE +.PP +\fB\-restoutseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +coderet is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/plotorf.1e +++ emboss-6.1.0/debian/manpages/plotorf.1e @@ -0,0 +1,72 @@ +'\" t +.\" Title: PLOTORF +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PLOTORF" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +plotorf \- Plot potential open reading frames in a nucleotide sequence +.SH "SYNOPSIS" +.HP \w'\fBplotorf\fR\ 'u +\fBplotorf\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-start\ \fR\fB\fIstring\fR\fR \fB\-stop\ \fR\fB\fIstring\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR +.HP \w'\fBplotorf\fR\ 'u +\fBplotorf\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBplotorf\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Gene finding,Nucleic:Translation" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-start\fR \fIstring\fR +.RS 4 +Default value: ATG +.RE +.PP +\fB\-stop\fR \fIstring\fR +.RS 4 +Default value: TAA,TAG,TGA +.RE +.SS "Output section" +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +plotorf is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/entrails.1e +++ emboss-6.1.0/debian/manpages/entrails.1e @@ -0,0 +1,62 @@ +'\" t +.\" Title: ENTRAILS +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ENTRAILS" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +entrails \- Reports the internal data from the EMBOSS code +.SH "SYNOPSIS" +.HP \w'\fBentrails\fR\ 'u +\fBentrails\fR [\fB\-fullreport\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBentrails\fR\ 'u +\fBentrails\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBentrails\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&. +.SH "OPTIONS" +.SS "Additional section" +.PP +\fB\-fullreport\fR \fIboolean\fR +.RS 4 +By default, only the essential details are reported Default value: N +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +entrails is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/emma.1e +++ emboss-6.1.0/debian/manpages/emma.1e @@ -0,0 +1,205 @@ +'\" t +.\" Title: EMMA +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "EMMA" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +emma \- Multiple sequence alignment (ClustalW wrapper) +.SH "SYNOPSIS" +.HP \w'\fBemma\fR\ 'u +\fBemma\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-onlydend\ \fR\fB\fItoggle\fR\fR] \fB\-dend\ \fR\fB\fItoggle\fR\fR \fB\-dendfile\ \fR\fB\fIinfile\fR\fR \fB\-pwmatrix\ \fR\fB\fIlist\fR\fR \fB\-pwdnamatrix\ \fR\fB\fIlist\fR\fR \fB\-usermatrix\ \fR\fB\fIvariable\fR\fR \fB\-pairwisedatafile\ \fR\fB\fIinfile\fR\fR \fB\-matrix\ \fR\fB\fIlist\fR\fR \fB\-usermamatrix\ \fR\fB\fIvariable\fR\fR \fB\-dnamatrix\ \fR\fB\fIlist\fR\fR \fB\-umamatrix\ \fR\fB\fIvariable\fR\fR \fB\-mamatrixfile\ \fR\fB\fIinfile\fR\fR [\fB\-slow\ \fR\fB\fItoggle\fR\fR] \fB\-pwgapopen\ \fR\fB\fIfloat\fR\fR \fB\-pwgapextend\ \fR\fB\fIfloat\fR\fR \fB\-ktup\ \fR\fB\fIinteger\fR\fR \fB\-gapw\ \fR\fB\fIinteger\fR\fR \fB\-topdiags\ \fR\fB\fIinteger\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-nopercent\ \fR\fB\fIboolean\fR\fR [\fB\-gapopen\ \fR\fB\fIfloat\fR\fR] [\fB\-gapextend\ \fR\fB\fIfloat\fR\fR] [\fB\-endgaps\ \fR\fB\fIboolean\fR\fR] [\fB\-gapdist\ \fR\fB\fIinteger\fR\fR] \fB\-norgap\ \fR\fB\fIboolean\fR\fR \fB\-hgapres\ \fR\fB\fIstring\fR\fR \fB\-nohgap\ \fR\fB\fIboolean\fR\fR [\fB\-maxdiv\ \fR\fB\fIinteger\fR\fR] \fB\-outseq\ \fR\fB\fIseqoutset\fR\fR \fB\-dendoutfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBemma\fR\ 'u +\fBemma\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBemma\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Multiple" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-onlydend\fR \fItoggle\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-dend\fR \fItoggle\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-dendfile\fR \fIinfile\fR +.RS 4 +.RE +.SS "Protein align options" +.PP +\fB\-pwmatrix\fR \fIlist\fR +.RS 4 +The scoring table which describes the similarity of each amino acid to each other\&. There are three \'in\-built\' series of weight matrices offered\&. Each consists of several matrices which work differently at different evolutionary distances\&. To see the exact details, read the documentation\&. Crudely, we store several matrices in memory, spanning the full range of amino acid distance (from almost identical sequences to highly divergent ones)\&. For very similar sequences, it is best to use a strict weight matrix which only gives a high score to identities and the most favoured conservative substitutions\&. For more divergent sequences, it is appropriate to use \'softer\' matrices which give a high score to many other frequent substitutions\&. 1) BLOSUM (Henikoff)\&. These matrices appear to be the best available for carrying out data base similarity (homology searches)\&. The matrices used are: Blosum80, 62, 45 and 30\&. 2) PAM (Dayhoff)\&. These have been extremely widely used since the late \'70s\&. We use the PAM 120, 160, 250 and 350 matrices\&. 3) GONNET \&. These matrices were derived using almost the same procedure as the Dayhoff one (above) but are much more up to date and are based on a far larger data set\&. They appear to be more sensitive than the Dayhoff series\&. We use the GONNET 40, 80, 120, 160, 250 and 350 matrices\&. We also supply an identity matrix which gives a score of 1\&.0 to two identical amino acids and a score of zero otherwise\&. This matrix is not very useful\&. Default value: b +.RE +.PP +\fB\-pwdnamatrix\fR \fIlist\fR +.RS 4 +The scoring table which describes the scores assigned to matches and mismatches (including IUB ambiguity codes)\&. Default value: i +.RE +.PP +\fB\-usermatrix\fR \fIvariable\fR +.RS 4 +.RE +.PP +\fB\-pairwisedatafile\fR \fIinfile\fR +.RS 4 +.RE +.SS "Matrix options" +.PP +\fB\-matrix\fR \fIlist\fR +.RS 4 +This gives a menu where you are offered a choice of weight matrices\&. The default for proteins is the PAM series derived by Gonnet and colleagues\&. Note, a series is used! The actual matrix that is used depends on how similar the sequences to be aligned at this alignment step are\&. Different matrices work differently at each evolutionary distance\&. There are three \'in\-built\' series of weight matrices offered\&. Each consists of several matrices which work differently at different evolutionary distances\&. To see the exact details, read the documentation\&. Crudely, we store several matrices in memory, spanning the full range of amino acid distance (from almost identical sequences to highly divergent ones)\&. For very similar sequences, it is best to use a strict weight matrix which only gives a high score to identities and the most favoured conservative substitutions\&. For more divergent sequences, it is appropriate to use \'softer\' matrices which give a high score to many other frequent substitutions\&. 1) BLOSUM (Henikoff)\&. These matrices appear to be the best available for carrying out data base similarity (homology searches)\&. The matrices used are: Blosum80, 62, 45 and 30\&. 2) PAM (Dayhoff)\&. These have been extremely widely used since the late \'70s\&. We use the PAM 120, 160, 250 and 350 matrices\&. 3) GONNET \&. These matrices were derived using almost the same procedure as the Dayhoff one (above) but are much more up to date and are based on a far larger data set\&. They appear to be more sensitive than the Dayhoff series\&. We use the GONNET 40, 80, 120, 160, 250 and 350 matrices\&. We also supply an identity matrix which gives a score of 1\&.0 to two identical amino acids and a score of zero otherwise\&. This matrix is not very useful\&. Alternatively, you can read in your own (just one matrix, not a series)\&. Default value: b +.RE +.PP +\fB\-usermamatrix\fR \fIvariable\fR +.RS 4 +.RE +.PP +\fB\-dnamatrix\fR \fIlist\fR +.RS 4 +This gives a menu where a single matrix (not a series) can be selected\&. Default value: i +.RE +.PP +\fB\-umamatrix\fR \fIvariable\fR +.RS 4 +.RE +.PP +\fB\-mamatrixfile\fR \fIinfile\fR +.RS 4 +.RE +.SS "Additional section" +.SS "Slow align options" +.PP +\fB\-slow\fR \fItoggle\fR +.RS 4 +A distance is calculated between every pair of sequences and these are used to construct the dendrogram which guides the final multiple alignment\&. The scores are calculated from separate pairwise alignments\&. These can be calculated using 2 methods: dynamic programming (slow but accurate) or by the method of Wilbur and Lipman (extremely fast but approximate)\&. The slow\-accurate method is fine for short sequences but will be VERY SLOW for many (e\&.g\&. >100) long (e\&.g\&. >1000 residue) sequences\&. Default value: Y +.RE +.PP +\fB\-pwgapopen\fR \fIfloat\fR +.RS 4 +The penalty for opening a gap in the pairwise alignments\&. Default value: 10\&.0 +.RE +.PP +\fB\-pwgapextend\fR \fIfloat\fR +.RS 4 +The penalty for extending a gap by 1 residue in the pairwise alignments\&. Default value: 0\&.1 +.RE +.SS "Fast align options" +.PP +\fB\-ktup\fR \fIinteger\fR +.RS 4 +This is the size of exactly matching fragment that is used\&. INCREASE for speed (max= 2 for proteins; 4 for DNA), DECREASE for sensitivity\&. For longer sequences (e\&.g\&. >1000 residues) you may need to increase the default\&. Default value: @($(acdprotein)?1:2) +.RE +.PP +\fB\-gapw\fR \fIinteger\fR +.RS 4 +This is a penalty for each gap in the fast alignments\&. It has little affect on the speed or sensitivity except for extreme values\&. Default value: @($(acdprotein)?3:5) +.RE +.PP +\fB\-topdiags\fR \fIinteger\fR +.RS 4 +The number of k\-tuple matches on each diagonal (in an imaginary dot\-matrix plot) is calculated\&. Only the best ones (with most matches) are used in the alignment\&. This parameter specifies how many\&. Decrease for speed; increase for sensitivity\&. Default value: @($(acdprotein)?5:4) +.RE +.PP +\fB\-window\fR \fIinteger\fR +.RS 4 +This is the number of diagonals around each of the \'best\' diagonals that will be used\&. Decrease for speed; increase for sensitivity\&. Default value: @($(acdprotein)?5:4) +.RE +.PP +\fB\-nopercent\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Gap options" +.PP +\fB\-gapopen\fR \fIfloat\fR +.RS 4 +The penalty for opening a gap in the alignment\&. Increasing the gap opening penalty will make gaps less frequent\&. Default value: 10\&.0 +.RE +.PP +\fB\-gapextend\fR \fIfloat\fR +.RS 4 +The penalty for extending a gap by 1 residue\&. Increasing the gap extension penalty will make gaps shorter\&. Terminal gaps are not penalised\&. Default value: 5\&.0 +.RE +.PP +\fB\-endgaps\fR \fIboolean\fR +.RS 4 +End gap separation: treats end gaps just like internal gaps for the purposes of avoiding gaps that are too close (set by \'gap separation distance\')\&. If you turn this off, end gaps will be ignored for this purpose\&. This is useful when you wish to align fragments where the end gaps are not biologically meaningful\&. Default value: Y +.RE +.PP +\fB\-gapdist\fR \fIinteger\fR +.RS 4 +Gap separation distance: tries to decrease the chances of gaps being too close to each other\&. Gaps that are less than this distance apart are penalised more than other gaps\&. This does not prevent close gaps; it makes them less frequent, promoting a block\-like appearance of the alignment\&. Default value: 8 +.RE +.PP +\fB\-norgap\fR \fIboolean\fR +.RS 4 +Residue specific penalties: amino acid specific gap penalties that reduce or increase the gap opening penalties at each position in the alignment or sequence\&. As an example, positions that are rich in glycine are more likely to have an adjacent gap than positions that are rich in valine\&. Default value: N +.RE +.PP +\fB\-hgapres\fR \fIstring\fR +.RS 4 +This is a set of the residues \'considered\' to be hydrophilic\&. It is used when introducing Hydrophilic gap penalties\&. Default value: GPSNDQEKR +.RE +.PP +\fB\-nohgap\fR \fIboolean\fR +.RS 4 +Hydrophilic gap penalties: used to increase the chances of a gap within a run (5 or more residues) of hydrophilic amino acids; these are likely to be loop or random coil regions where gaps are more common\&. The residues that are \'considered\' to be hydrophilic are set by \'\-hgapres\'\&. Default value: N +.RE +.PP +\fB\-maxdiv\fR \fIinteger\fR +.RS 4 +This switch, delays the alignment of the most distantly related sequences until after the most closely related sequences have been aligned\&. The setting shows the percent identity level required to delay the addition of a sequence; sequences that are less identical than this level to any other sequences will be aligned later\&. Default value: 30 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutset\fR +.RS 4 +.RE +.PP +\fB\-dendoutfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +emma is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/sigcleave.1e +++ emboss-6.1.0/debian/manpages/sigcleave.1e @@ -0,0 +1,73 @@ +'\" t +.\" Title: SIGCLEAVE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SIGCLEAVE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +sigcleave \- Reports on signal cleavage sites in a protein sequence +.SH "SYNOPSIS" +.HP \w'\fBsigcleave\fR\ 'u +\fBsigcleave\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-minweight\ \fR\fB\fIfloat\fR\fR [\fB\-prokaryote\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBsigcleave\fR\ 'u +\fBsigcleave\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBsigcleave\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Motifs" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-minweight\fR \fIfloat\fR +.RS 4 +Minimum scoring weight value for the predicted cleavage site Default value: 3\&.5 +.RE +.SS "Additional section" +.PP +\fB\-prokaryote\fR \fIboolean\fR +.RS 4 +Specifies the sequence is prokaryotic and changes the default scoring data file name +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +sigcleave is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/codcopy.1e +++ emboss-6.1.0/debian/manpages/codcopy.1e @@ -0,0 +1,62 @@ +'\" t +.\" Title: CODCOPY +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CODCOPY" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +codcopy \- Copy and reformat a codon usage table +.SH "SYNOPSIS" +.HP \w'\fBcodcopy\fR\ 'u +\fBcodcopy\fR \fB\-infile\ \fR\fB\fIcodon\fR\fR \fB\-outfile\ \fR\fB\fIoutcodon\fR\fR +.HP \w'\fBcodcopy\fR\ 'u +\fBcodcopy\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBcodcopy\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIcodon\fR +.RS 4 +.RE +.SS "Advanced section" +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutcodon\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +codcopy is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/complex.1e +++ emboss-6.1.0/debian/manpages/complex.1e @@ -0,0 +1,111 @@ +'\" t +.\" Title: COMPLEX +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "COMPLEX" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +complex \- Find the linguistic complexity in nucleotide sequences +.SH "SYNOPSIS" +.HP \w'\fBcomplex\fR\ 'u +\fBcomplex\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-lwin\ \fR\fB\fIinteger\fR\fR \fB\-step\ \fR\fB\fIinteger\fR\fR \fB\-jmin\ \fR\fB\fIinteger\fR\fR \fB\-jmax\ \fR\fB\fIinteger\fR\fR \fB\-omnia\ \fR\fB\fItoggle\fR\fR \fB\-sim\ \fR\fB\fIinteger\fR\fR \fB\-freq\ \fR\fB\fIboolean\fR\fR \fB\-print\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-ujtablefile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBcomplex\fR\ 'u +\fBcomplex\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBcomplex\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-lwin\fR \fIinteger\fR +.RS 4 +Default value: 100 +.RE +.PP +\fB\-step\fR \fIinteger\fR +.RS 4 +Displacement of the window over the sequence Default value: 5 +.RE +.PP +\fB\-jmin\fR \fIinteger\fR +.RS 4 +Default value: 4 +.RE +.PP +\fB\-jmax\fR \fIinteger\fR +.RS 4 +Default value: 6 +.RE +.SS "Advanced section" +.PP +\fB\-omnia\fR \fItoggle\fR +.RS 4 +Calculate over a set of sequences Default value: N +.RE +.PP +\fB\-sim\fR \fIinteger\fR +.RS 4 +Calculate the linguistic complexity by comparison with a number of simulations having a uniform distribution of bases +.RE +.PP +\fB\-freq\fR \fIboolean\fR +.RS 4 +Execute the simulation of a sequence based on the base frequency of the original sequence Default value: N +.RE +.SS "Output section" +.PP +\fB\-print\fR \fIboolean\fR +.RS 4 +Generate a file named UjTable containing the values of Uj for each word j in the real sequence(s) and in any simulated sequences Default value: N +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-ujtablefile\fR \fIoutfile\fR +.RS 4 +Default value: complex\&.ujtable +.RE +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +complex is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/demostring.1e +++ emboss-6.1.0/debian/manpages/demostring.1e @@ -0,0 +1,56 @@ +'\" t +.\" Title: DEMOSTRING +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DEMOSTRING" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +demostring \- Demonstration of the string functions +.SH "SYNOPSIS" +.HP \w'\fBdemostring\fR\ 'u +\fBdemostring\fR \fB\-instring\ \fR\fB\fIstring\fR\fR +.HP \w'\fBdemostring\fR\ 'u +\fBdemostring\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdemostring\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-instring\fR \fIstring\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +demostring is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/nospace.1e +++ emboss-6.1.0/debian/manpages/nospace.1e @@ -0,0 +1,64 @@ +'\" t +.\" Title: NOSPACE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "NOSPACE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +nospace \- Remove all whitespace from an ASCII text file +.SH "SYNOPSIS" +.HP \w'\fBnospace\fR\ 'u +\fBnospace\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBnospace\fR\ 'u +\fBnospace\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBnospace\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.SS "Required section" +.SS "Additional section" +.SS "Advanced section" +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +nospace is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/acdc.1e +++ emboss-6.1.0/debian/manpages/acdc.1e @@ -0,0 +1,51 @@ +'\" t +.\" Title: ACDC +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ACDC" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +acdc \- Test an application ACD file +.SH "SYNOPSIS" +.HP \w'\fBacdc\fR\ 'u +\fBacdc\fR +.HP \w'\fBacdc\fR\ 'u +\fBacdc\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBacdc\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd" command group(s)\&. +.SH "OPTIONS" +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +acdc is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/syco.1e +++ emboss-6.1.0/debian/manpages/syco.1e @@ -0,0 +1,91 @@ +'\" t +.\" Title: SYCO +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SYCO" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +syco \- Draw synonymous codon usage statictic plot for a nucleotide sequence +.SH "SYNOPSIS" +.HP \w'\fBsyco\fR\ 'u +\fBsyco\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-cfile\ \fR\fB\fIcodon\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-uncommon\ \fR\fB\fIboolean\fR\fR \fB\-minimum\ \fR\fB\fIfloat\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBsyco\fR\ 'u +\fBsyco\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBsyco\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Codon usage,Nucleic:Gene finding" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-cfile\fR \fIcodon\fR +.RS 4 +Codon usage file +.RE +.SS "Advanced section" +.PP +\fB\-window\fR \fIinteger\fR +.RS 4 +Default value: 30 +.RE +.PP +\fB\-uncommon\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-minimum\fR \fIfloat\fR +.RS 4 +Default value: \&.15 +.RE +.SS "Output section" +.PP +\fB\-plot\fR \fItoggle\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +syco is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/origunion.1e +++ emboss-6.1.0/debian/manpages/origunion.1e @@ -0,0 +1,61 @@ +'\" t +.\" Title: ORIGUNION +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ORIGUNION" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +origunion \- Reads sequence fragments and builds one sequence +.SH "SYNOPSIS" +.HP \w'\fBorigunion\fR\ 'u +\fBorigunion\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR +.HP \w'\fBorigunion\fR\ 'u +\fBorigunion\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBorigunion\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +origunion is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/oddcomp.1e +++ emboss-6.1.0/debian/manpages/oddcomp.1e @@ -0,0 +1,84 @@ +'\" t +.\" Title: ODDCOMP +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ODDCOMP" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +oddcomp \- Identify proteins with specified sequence word composition +.SH "SYNOPSIS" +.HP \w'\fBoddcomp\fR\ 'u +\fBoddcomp\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-fullwindow\ \fR\fB\fItoggle\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-ignorebz\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBoddcomp\fR\ 'u +\fBoddcomp\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBoddcomp\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Motifs" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +This is a file in the format of the output produced by \'compseq\' that is used to set the minimum frequencies of words in this analysis\&. +.RE +.SS "Required section" +.PP +\fB\-fullwindow\fR \fItoggle\fR +.RS 4 +Set this option on (Y) if you want the window size to be set to the length of the current protein\&. Otherwise, leave this option unset, in which case you\'ll be prompted for a window size to use\&. Default value: N +.RE +.PP +\fB\-window\fR \fIinteger\fR +.RS 4 +This is the size of window in which to count\&. Thus if you want to count frequencies in a 40 aa stretch you should enter 40 here\&. Default value: 30 +.RE +.SS "Advanced section" +.PP +\fB\-ignorebz\fR \fIboolean\fR +.RS 4 +The amino acid code B represents Asparagine or Aspartic acid and the code Z represents Glutamine or Glutamic acid\&. These are not commonly used codes and you may wish not to count words containing them, just noting them in the count of \'Other\' words\&. Default value: Y +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +This is the results file\&. +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +oddcomp is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/edialign.1e +++ emboss-6.1.0/debian/manpages/edialign.1e @@ -0,0 +1,126 @@ +'\" t +.\" Title: EDIALIGN +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "EDIALIGN" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +edialign \- Local multiple alignment of sequences +.SH "SYNOPSIS" +.HP \w'\fBedialign\fR\ 'u +\fBedialign\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR \fB\-nucmode\ \fR\fB\fIlist\fR\fR \fB\-revcomp\ \fR\fB\fIboolean\fR\fR [\fB\-overlapw\ \fR\fB\fIselection\fR\fR] [\fB\-linkage\ \fR\fB\fIlist\fR\fR] [\fB\-maxfragl\ \fR\fB\fIinteger\fR\fR] \fB\-fragmat\ \fR\fB\fIboolean\fR\fR \fB\-fragsim\ \fR\fB\fIinteger\fR\fR [\fB\-itscore\ \fR\fB\fIboolean\fR\fR] [\fB\-threshold\ \fR\fB\fIfloat\fR\fR] \fB\-mask\ \fR\fB\fIboolean\fR\fR \fB\-dostars\ \fR\fB\fIboolean\fR\fR \fB\-starnum\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBedialign\fR\ 'u +\fBedialign\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBedialign\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Multiple" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequences\fR \fIseqset\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-nucmode\fR \fIlist\fR +.RS 4 +Nucleic acid sequence alignment mode (simple, translated or mixed) Default value: n +.RE +.PP +\fB\-revcomp\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-overlapw\fR \fIselection\fR +.RS 4 +By default overlap weights are used when Nseq =<35 but you can set this to \'yes\' or \'no\' Default value: default (when Nseq =< 35) +.RE +.PP +\fB\-linkage\fR \fIlist\fR +.RS 4 +Clustering method to construct sequence tree (UPGMA, minimum linkage or maximum linkage) Default value: UPGMA +.RE +.PP +\fB\-maxfragl\fR \fIinteger\fR +.RS 4 +Default value: 40 +.RE +.PP +\fB\-fragmat\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-fragsim\fR \fIinteger\fR +.RS 4 +Default value: 4 +.RE +.PP +\fB\-itscore\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-threshold\fR \fIfloat\fR +.RS 4 +Default value: 0\&.0 +.RE +.SS "Output section" +.PP +\fB\-mask\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-dostars\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-starnum\fR \fIinteger\fR +.RS 4 +Default value: 4 +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +edialign is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/sirna.1e +++ emboss-6.1.0/debian/manpages/sirna.1e @@ -0,0 +1,93 @@ +'\" t +.\" Title: SIRNA +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SIRNA" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +sirna \- Finds siRNA duplexes in mRNA +.SH "SYNOPSIS" +.HP \w'\fBsirna\fR\ 'u +\fBsirna\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-poliii\ \fR\fB\fIboolean\fR\fR] [\fB\-aa\ \fR\fB\fIboolean\fR\fR] [\fB\-tt\ \fR\fB\fIboolean\fR\fR] [\fB\-polybase\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIreport\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR [\fB\-context\ \fR\fB\fIboolean\fR\fR] +.HP \w'\fBsirna\fR\ 'u +\fBsirna\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBsirna\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Sequence input options" +.PP +\fB\-poliii\fR \fIboolean\fR +.RS 4 +This option allows you to select only the 21 base probes that start with a purine and so can be expressed from Pol III expression vectors\&. This is the NARN(17)YNN pattern that has been suggested by Tuschl et al\&. Default value: N +.RE +.PP +\fB\-aa\fR \fIboolean\fR +.RS 4 +This option allows you to select only those 23 base regions that start with AA\&. If this option is not selected then regions that start with AA will be favoured by giving them a higher score, but regions that do not start with AA will also be reported\&. Default value: N +.RE +.PP +\fB\-tt\fR \fIboolean\fR +.RS 4 +This option allows you to select only those 23 base regions that end with TT\&. If this option is not selected then regions that end with TT will be favoured by giving them a higher score, but regions that do not end with TT will also be reported\&. Default value: N +.RE +.PP +\fB\-polybase\fR \fIboolean\fR +.RS 4 +If this option is FALSE then only those 23 base regions that have no repeat of 4 or more of any bases in a row will be reported\&. No regions will ever be reported that have 4 or more G\'s in a row\&. Default value: Y +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +The output is a table of the forward and reverse parts of the 21 base siRNA duplex\&. Both the forward and reverse sequences are written 5\' to 3\', ready to be ordered\&. The last two bases have been replaced by \'dTdT\'\&. The starting position of the 23 base region and the %GC content is also given\&. If you wish to see the complete 23 base sequence, then either look at the sequence in the other output file, or use the qualifier \'\-context\' which will display the 23 bases of the forward sequence in this report withthe first two bases in brackets\&. These first two bases do not form part of the siRNA probe to be ordered\&. +.RE +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +This is a file of the sequences of the 23 base regions that the siRNAs are selected from\&. You may use it to do searches of mRNA databases (e\&.g\&. REFSEQ) to confirm that the probes are unique to the gene you wish to use it on\&. +.RE +.PP +\fB\-context\fR \fIboolean\fR +.RS 4 +The output report file gives the sequences of the 21 base siRNA regions ready to be ordered\&. This does not give you an indication of the 2 bases before the 21 bases\&. It is often interesting to see which of the suggested possible probe regions have an \'AA\' in front of them (i\&.e\&. it is useful to see which of the 23 base regions start with an \'AA\')\&. This option displays the whole 23 bases of the region with the first two bases in brackets, e\&.g\&. \'(AA)\' to give you some context for the probe region\&. YOU SHOULD NOT INCLUDE THE TWO BASES IN BRACKETS WHEN YOU PLACE AN ORDER FOR THE PROBES\&. Default value: N +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +sirna is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/skipredundant.1e +++ emboss-6.1.0/debian/manpages/skipredundant.1e @@ -0,0 +1,107 @@ +'\" t +.\" Title: SKIPREDUNDANT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SKIPREDUNDANT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +skipredundant \- Remove redundant sequences from an input set +.SH "SYNOPSIS" +.HP \w'\fBskipredundant\fR\ 'u +\fBskipredundant\fR \fB\-feature\ \fR\fB\fItoggle\fR\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR [\fB\-datafile\ \fR\fB\fImatrixf\fR\fR] \fB\-mode\ \fR\fB\fIlist\fR\fR \fB\-threshold\ \fR\fB\fIfloat\fR\fR \fB\-minthreshold\ \fR\fB\fIfloat\fR\fR \fB\-maxthreshold\ \fR\fB\fIfloat\fR\fR \fB\-gapopen\ \fR\fB\fIfloat\fR\fR \fB\-gapextend\ \fR\fB\fIfloat\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR \fB\-redundantoutseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBskipredundant\fR\ 'u +\fBskipredundant\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBskipredundant\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-feature\fR \fItoggle\fR +.RS 4 +Sequence feature information will be retained if this option is set\&. +.RE +.PP +\fB\-sequences\fR \fIseqset\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fImatrixf\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.SS "Required section" +.PP +\fB\-mode\fR \fIlist\fR +.RS 4 +This option specifies whether to remove redundancy at a single threshold percentage sequence similarity or remove redundancy outside a range of acceptable threshold percentage similarity\&. All permutations of pair\-wise sequence alignments are calculated for each set of input sequences in turn using the EMBOSS implementation of the Needleman and Wunsch global alignment algorithm\&. Redundant sequences are removed in one of two modes as follows: (i) If a pair of proteins achieve greater than a threshold percentage sequence similarity (specified by the user) the shortest sequence is discarded\&. (ii) If a pair of proteins have a percentage sequence similarity that lies outside an acceptable range (specified by the user) the shortest sequence is discarded\&. Default value: 1 +.RE +.PP +\fB\-threshold\fR \fIfloat\fR +.RS 4 +This option specifies the percentage sequence identity redundancy threshold\&. The percentage sequence identity redundancy threshold determines the redundancy calculation\&. If a pair of proteins achieve greater than this threshold the shortest sequence is discarded\&. Default value: 95\&.0 +.RE +.PP +\fB\-minthreshold\fR \fIfloat\fR +.RS 4 +This option specifies the percentage sequence identity redundancy threshold (lower limit)\&. The percentage sequence identity redundancy threshold determines the redundancy calculation\&. If a pair of proteins have a percentage sequence similarity that lies outside an acceptable range the shortest sequence is discarded\&. Default value: 30\&.0 +.RE +.PP +\fB\-maxthreshold\fR \fIfloat\fR +.RS 4 +This option specifies the percentage sequence identity redundancy threshold (upper limit)\&. The percentage sequence identity redundancy threshold determines the redundancy calculation\&. If a pair of proteins have a percentage sequence similarity that lies outside an acceptable range the shortest sequence is discarded\&. Default value: 90\&.0 +.RE +.PP +\fB\-gapopen\fR \fIfloat\fR +.RS 4 +The gap open penalty is the score taken away when a gap is created\&. The best value depends on the choice of comparison matrix\&. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences\&. Default value: @($(acdprotein)? 10\&.0 : 10\&.0 ) +.RE +.PP +\fB\-gapextend\fR \fIfloat\fR +.RS 4 +The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap\&. This is how long gaps are penalized\&. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty\&. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps\&. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring\&. Default value: @($(acdprotein)? 0\&.5 : 0\&.5 ) +.RE +.SS "Advanced section" +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.PP +\fB\-redundantoutseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +skipredundant is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/primers.1e +++ emboss-6.1.0/debian/manpages/primers.1e @@ -0,0 +1,93 @@ +'\" t +.\" Title: PRIMERS +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PRIMERS" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +primers \- Simple version of primer3 to pick PCR primers +.SH "SYNOPSIS" +.HP \w'\fBprimers\fR\ 'u +\fBprimers\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-target\ \fR\fB\fIrange\fR\fR] [\fB\-minsize\ \fR\fB\fIinteger\fR\fR] [\fB\-maxsize\ \fR\fB\fIinteger\fR\fR] [\fB\-maxdifftm\ \fR\fB\fIfloat\fR\fR] [\fB\-explainflag\ \fR\fB\fIboolean\fR\fR] [\fB\-numreturn\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBprimers\fR\ 'u +\fBprimers\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBprimers\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Primers" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +The sequence from which to choose primers\&. The sequence must be presented 5\' \-> 3\' +.RE +.SS "Additional section" +.PP +\fB\-target\fR \fIrange\fR +.RS 4 +If one or more Targets is specified then a legal primer pair must flank at least one of them\&. A Target might be a simple sequence repeat site (for example a CA repeat) or a single\-base\-pair polymorphism\&. The value should be a space\-separated list of , pairs where is the index of the first base of a Target, and is the last E\&.g\&. 50,51 requires primers to surround the 2 bases at positions 50 and 51\&. +.RE +.PP +\fB\-minsize\fR \fIinteger\fR +.RS 4 +Minimum acceptable length of a primer\&. Must be greater than 0 and less than or equal to MAX\-SIZE\&. Default value: 18 +.RE +.PP +\fB\-maxsize\fR \fIinteger\fR +.RS 4 +Maximum acceptable length (in bases) of a primer\&. Currently this parameter cannot be larger than 35\&. This limit is governed by the maximum oligo size for which Primer3\'s melting\-temperature is valid\&. Default value: 27 +.RE +.PP +\fB\-maxdifftm\fR \fIfloat\fR +.RS 4 +Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers\&. Default value: 100\&.0 +.RE +.SS "Output section" +.PP +\fB\-explainflag\fR \fIboolean\fR +.RS 4 +If this flag is non\-0, produce LEFT\-EXPLAIN and RIGHT\-EXPLAIN, output, which are intended to provide information on the number of primer pairs that Primer3 examined, and statistics on the number discarded for various reasons\&. Default value: N +.RE +.PP +\fB\-numreturn\fR \fIinteger\fR +.RS 4 +The maximum number of primer pairs to return\&. Primer pairs returned are sorted by their \'quality\', in other words by the value of the objective function (where a lower number indicates a better primer pair)\&. Caution: setting this parameter to a large value will increase running time\&. Default value: 5 +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +primers is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/patmatdb.1e +++ emboss-6.1.0/debian/manpages/patmatdb.1e @@ -0,0 +1,67 @@ +'\" t +.\" Title: PATMATDB +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PATMATDB" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +patmatdb \- Searches protein sequences with a sequence motif +.SH "SYNOPSIS" +.HP \w'\fBpatmatdb\fR\ 'u +\fBpatmatdb\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-motif\ \fR\fB\fIstring\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBpatmatdb\fR\ 'u +\fBpatmatdb\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBpatmatdb\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Motifs" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-motif\fR \fIstring\fR +.RS 4 +Patterns for patmatdb are based on the format of pattern used in the PROSITE database\&. For example: \'[DE](2)HS{P}X(2)PX(2,4)C\' means two Asps or Glus in any order followed by His, Ser, any residue other then Pro, then two of any residue followed by Pro followed by two to four of any residue followed by Cys\&. The search is case\-independent, so \'AAA\' matches \'aaa\'\&. +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +patmatdb is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/diffseq.1e +++ emboss-6.1.0/debian/manpages/diffseq.1e @@ -0,0 +1,87 @@ +'\" t +.\" Title: DIFFSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DIFFSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +diffseq \- Compare and report features of two similar sequences +.SH "SYNOPSIS" +.HP \w'\fBdiffseq\fR\ 'u +\fBdiffseq\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR [\fB\-globaldifferences\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIreport\fR\fR \fB\-aoutfeat\ \fR\fB\fIfeatout\fR\fR \fB\-boutfeat\ \fR\fB\fIfeatout\fR\fR +.HP \w'\fBdiffseq\fR\ 'u +\fBdiffseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdiffseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Differences" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-asequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-bsequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-wordsize\fR \fIinteger\fR +.RS 4 +The similar regions between the two sequences are found by creating a hash table of \'wordsize\'d subsequences\&. 10 is a reasonable default\&. Making this value larger (20?) may speed up the program slightly, but will mean that any two differences within \'wordsize\' of each other will be grouped as a single region of difference\&. This value may be made smaller (4?) to improve the resolution of nearby differences, but the program will go much slower\&. Default value: 10 +.RE +.SS "Additional section" +.PP +\fB\-globaldifferences\fR \fIboolean\fR +.RS 4 +Normally this program will find regions of identity that are the length of the specified word\-size or greater and will then report the regions of difference between these matching regions\&. This works well and is what most people want if they are working with long overlapping nucleic acid sequences\&. You are usually not interested in the non\-overlapping ends of these sequences\&. If you have protein sequences or short RNA sequences however, you will be interested in differences at the very ends \&. It this option is set to be true then the differences at the ends will also be reported\&. Default value: N +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.PP +\fB\-aoutfeat\fR \fIfeatout\fR +.RS 4 +File for output of first sequence\'s features Default value: $(asequence\&.name)\&.diffgff +.RE +.PP +\fB\-boutfeat\fR \fIfeatout\fR +.RS 4 +File for output of second sequence\'s features Default value: $(bsequence\&.name)\&.diffgff +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +diffseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/remap.1e +++ emboss-6.1.0/debian/manpages/remap.1e @@ -0,0 +1,216 @@ +'\" t +.\" Title: REMAP +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "REMAP" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +remap \- Display restriction enzyme binding sites in a nucleotide sequence +.SH "SYNOPSIS" +.HP \w'\fBremap\fR\ 'u +\fBremap\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-mfile\ \fR\fB\fIdatafile\fR\fR \fB\-enzymes\ \fR\fB\fIstring\fR\fR \fB\-sitelen\ \fR\fB\fIinteger\fR\fR [\fB\-mincuts\ \fR\fB\fIinteger\fR\fR] [\fB\-maxcuts\ \fR\fB\fIinteger\fR\fR] [\fB\-single\ \fR\fB\fIboolean\fR\fR] [\fB\-blunt\ \fR\fB\fIboolean\fR\fR] [\fB\-sticky\ \fR\fB\fIboolean\fR\fR] [\fB\-ambiguity\ \fR\fB\fIboolean\fR\fR] [\fB\-plasmid\ \fR\fB\fIboolean\fR\fR] [\fB\-methylation\ \fR\fB\fIboolean\fR\fR] [\fB\-commercial\ \fR\fB\fIboolean\fR\fR] [\fB\-table\ \fR\fB\fIlist\fR\fR] [\fB\-frame\ \fR\fB\fIlist\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR [\fB\-cutlist\ \fR\fB\fIboolean\fR\fR] [\fB\-flatreformat\ \fR\fB\fIboolean\fR\fR] [\fB\-limit\ \fR\fB\fIboolean\fR\fR] \fB\-translation\ \fR\fB\fIboolean\fR\fR \fB\-reverse\ \fR\fB\fIboolean\fR\fR \fB\-orfminsize\ \fR\fB\fIinteger\fR\fR \fB\-uppercase\ \fR\fB\fIrange\fR\fR \fB\-highlight\ \fR\fB\fIrange\fR\fR \fB\-threeletter\ \fR\fB\fIboolean\fR\fR \fB\-number\ \fR\fB\fIboolean\fR\fR \fB\-width\ \fR\fB\fIinteger\fR\fR \fB\-length\ \fR\fB\fIinteger\fR\fR \fB\-margin\ \fR\fB\fIinteger\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR \fB\-offset\ \fR\fB\fIinteger\fR\fR \fB\-html\ \fR\fB\fIboolean\fR\fR +.HP \w'\fBremap\fR\ 'u +\fBremap\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBremap\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Nucleic:Restriction,Nucleic:Translation" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-mfile\fR \fIdatafile\fR +.RS 4 +Default value: Emethylsites\&.dat +.RE +.SS "Required section" +.PP +\fB\-enzymes\fR \fIstring\fR +.RS 4 +The name \'all\' reads in all enzyme names from the REBASE database\&. You can specify enzymes by giving their names with commas between then, such as: \'HincII,hinfI,ppiI,hindiii\'\&. The case of the names is not important\&. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a \'@\' character in front of it, for example, \'@enz\&.list\'\&. Blank lines and lines starting with a hash character or \'!\' are ignored and all other lines are concatenated together with a comma character \',\' and then treated as the list of enzymes to search for\&. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Default value: all +.RE +.PP +\fB\-sitelen\fR \fIinteger\fR +.RS 4 +This sets the minimum length of the restriction enzyme recognition site\&. Any enzymes with sites shorter than this will be ignored\&. Default value: 4 +.RE +.SS "Additional section" +.PP +\fB\-mincuts\fR \fIinteger\fR +.RS 4 +This sets the minimum number of cuts for any restriction enzyme that will be considered\&. Any enzymes that cut fewer times than this will be ignored\&. Default value: 1 +.RE +.PP +\fB\-maxcuts\fR \fIinteger\fR +.RS 4 +This sets the maximum number of cuts for any restriction enzyme that will be considered\&. Any enzymes that cut more times than this will be ignored\&. Default value: 2000000000 +.RE +.PP +\fB\-single\fR \fIboolean\fR +.RS 4 +If this is set then this forces the values of the mincuts and maxcuts qualifiers to both be 1\&. Any other value you may have set them to will be ignored\&. Default value: N +.RE +.PP +\fB\-blunt\fR \fIboolean\fR +.RS 4 +This allows those enzymes which cut at the same position on the forward and reverse strands to be considered\&. Default value: Y +.RE +.PP +\fB\-sticky\fR \fIboolean\fR +.RS 4 +This allows those enzymes which cut at different positions on the forward and reverse strands, leaving an overhang, to be considered\&. Default value: Y +.RE +.PP +\fB\-ambiguity\fR \fIboolean\fR +.RS 4 +This allows those enzymes which have one or more \'N\' ambiguity codes in their pattern to be considered Default value: Y +.RE +.PP +\fB\-plasmid\fR \fIboolean\fR +.RS 4 +If this is set then this allows searches for restriction enzyme recognition site and cut postions that span the end of the sequence to be considered\&. Default value: N +.RE +.PP +\fB\-methylation\fR \fIboolean\fR +.RS 4 +If this is set then RE recognition sites will not match methylated bases\&. Default value: N +.RE +.PP +\fB\-commercial\fR \fIboolean\fR +.RS 4 +If this is set, then only those enzymes with a commercial supplier will be searched for\&. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through \'all\' the enzymes in the REBASE database\&. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier\&. Default value: Y +.RE +.PP +\fB\-table\fR \fIlist\fR +.RS 4 +.RE +.PP +\fB\-frame\fR \fIlist\fR +.RS 4 +This allows you to specify the frames that are translated\&. If you are not displaying cut sites on the reverse sense, then the reverse sense translations will not be displayed even if you have requested frames 4, 5 or 6\&. By default, all six frames will be displayed\&. Default value: 6 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-cutlist\fR \fIboolean\fR +.RS 4 +This produces lists in the output of the enzymes that cut, those that cut but are excluded because that cut fewer times than mincut or more times than maxcut and those enzymes that do not cut\&. Default value: Y +.RE +.PP +\fB\-flatreformat\fR \fIboolean\fR +.RS 4 +This changes the output format to one where the recognition site is indicated by a row of \'===\' characters and the cut site is pointed to by a \'>\' character in the forward sense, or a \'<\' in the reverse sense strand\&. Default value: N +.RE +.PP +\fB\-limit\fR \fIboolean\fR +.RS 4 +This limits the reporting of enzymes to just one enzyme from each group of isoschizomers\&. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file \'embossre\&.equ\', which is created by the program \'rebaseextract\'\&. If you prefer different prototypes to be used, make a copy of embossre\&.equ in your home directory and edit it\&. If this value is set to be false then all of the input enzymes will be reported\&. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching \'all\' of them\&. Default value: Y +.RE +.PP +\fB\-translation\fR \fIboolean\fR +.RS 4 +This displays the 6\-frame translations of the sequence in the output\&. Default value: Y +.RE +.PP +\fB\-reverse\fR \fIboolean\fR +.RS 4 +This displays the cut sites and translation of the reverse sense\&. Default value: Y +.RE +.PP +\fB\-orfminsize\fR \fIinteger\fR +.RS 4 +This sets the minimum size of Open Reading Frames (ORFs) to display in the translations\&. All other translation regions are masked by changing the amino acids to \'\-\' characters\&. +.RE +.PP +\fB\-uppercase\fR \fIrange\fR +.RS 4 +Regions to put in uppercase\&. If this is left blank, then the sequence case is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are separated by any non\-digit, non\-alpha character\&. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765\&.\&.888 1,5,8,10,23,45,57,99 +.RE +.PP +\fB\-highlight\fR \fIrange\fR +.RS 4 +Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \'@filename\'\&. +.RE +.PP +\fB\-threeletter\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-number\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-width\fR \fIinteger\fR +.RS 4 +Default value: 60 +.RE +.PP +\fB\-length\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-margin\fR \fIinteger\fR +.RS 4 +Default value: 10 +.RE +.PP +\fB\-name\fR \fIboolean\fR +.RS 4 +Set this to be false if you do not wish to display the ID name of the sequence Default value: Y +.RE +.PP +\fB\-description\fR \fIboolean\fR +.RS 4 +Set this to be false if you do not wish to display the description of the sequence Default value: Y +.RE +.PP +\fB\-offset\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-html\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +remap is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/recoder.1e +++ emboss-6.1.0/debian/manpages/recoder.1e @@ -0,0 +1,77 @@ +'\" t +.\" Title: RECODER +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "RECODER" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +recoder \- Find restriction sites to remove (mutate) with no translation change +.SH "SYNOPSIS" +.HP \w'\fBrecoder\fR\ 'u +\fBrecoder\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-enzymes\ \fR\fB\fIstring\fR\fR \fB\-sshow\ \fR\fB\fIboolean\fR\fR \fB\-tshow\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBrecoder\fR\ 'u +\fBrecoder\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBrecoder\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Restriction" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-enzymes\fR \fIstring\fR +.RS 4 +Default value: all +.RE +.SS "Output section" +.PP +\fB\-sshow\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-tshow\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +recoder is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/seqinfo.1e +++ emboss-6.1.0/debian/manpages/seqinfo.1e @@ -0,0 +1,62 @@ +'\" t +.\" Title: SEQINFO +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SEQINFO" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +seqinfo \- Returns sequence information +.SH "SYNOPSIS" +.HP \w'\fBseqinfo\fR\ 'u +\fBseqinfo\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBseqinfo\fR\ 'u +\fBseqinfo\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBseqinfo\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +Default value: stdout +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +seqinfo is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/density.1e +++ emboss-6.1.0/debian/manpages/density.1e @@ -0,0 +1,80 @@ +'\" t +.\" Title: DENSITY +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DENSITY" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +density \- Draw a nucleic acid density plot +.SH "SYNOPSIS" +.HP \w'\fBdensity\fR\ 'u +\fBdensity\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR [\fB\-window\ \fR\fB\fIinteger\fR\fR] [\fB\-display\ \fR\fB\fIlist\fR\fR] \fB\-isdual\ \fR\fB\fIvariable\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBdensity\fR\ 'u +\fBdensity\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdensity\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-seqall\fR \fIseqall\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-window\fR \fIinteger\fR +.RS 4 +Default value: 100 +.RE +.PP +\fB\-display\fR \fIlist\fR +.RS 4 +Default value: none +.RE +.SS "Output section" +.PP +\fB\-isdual\fR \fIvariable\fR +.RS 4 +.RE +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +density is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/needle.1e +++ emboss-6.1.0/debian/manpages/needle.1e @@ -0,0 +1,86 @@ +'\" t +.\" Title: NEEDLE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "NEEDLE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +needle \- Needleman\-Wunsch global alignment of two sequences +.SH "SYNOPSIS" +.HP \w'\fBneedle\fR\ 'u +\fBneedle\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIseqall\fR\fR [\fB\-datafile\ \fR\fB\fImatrixf\fR\fR] \fB\-gapopen\ \fR\fB\fIfloat\fR\fR \fB\-gapextend\ \fR\fB\fIfloat\fR\fR \fB\-brief\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIalign\fR\fR +.HP \w'\fBneedle\fR\ 'u +\fBneedle\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBneedle\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Global" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-asequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-bsequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fImatrixf\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.SS "Required section" +.PP +\fB\-gapopen\fR \fIfloat\fR +.RS 4 +The gap open penalty is the score taken away when a gap is created\&. The best value depends on the choice of comparison matrix\&. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences\&. Default value: @($(acdprotein)? 10\&.0 : 10\&.0 ) +.RE +.PP +\fB\-gapextend\fR \fIfloat\fR +.RS 4 +The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap\&. This is how long gaps are penalized\&. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty\&. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps\&. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring\&. Default value: @($(acdprotein)? 0\&.5 : 0\&.5 ) +.RE +.SS "Output section" +.PP +\fB\-brief\fR \fIboolean\fR +.RS 4 +Brief identity and similarity Default value: Y +.RE +.PP +\fB\-outfile\fR \fIalign\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +needle is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/profit.1e +++ emboss-6.1.0/debian/manpages/profit.1e @@ -0,0 +1,65 @@ +'\" t +.\" Title: PROFIT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PROFIT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +profit \- Scan one or more sequences with a simple frequency matrix +.SH "SYNOPSIS" +.HP \w'\fBprofit\fR\ 'u +\fBprofit\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBprofit\fR\ 'u +\fBprofit\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBprofit\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Profiles,Protein:Profiles" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +profit is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/iep.1e +++ emboss-6.1.0/debian/manpages/iep.1e @@ -0,0 +1,105 @@ +'\" t +.\" Title: IEP +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "IEP" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +iep \- Calculate the isoelectric point of proteins +.SH "SYNOPSIS" +.HP \w'\fBiep\fR\ 'u +\fBiep\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-amino\ \fR\fB\fIinteger\fR\fR] [\fB\-carboxyl\ \fR\fB\fIinteger\fR\fR] [\fB\-termini\ \fR\fB\fIboolean\fR\fR] [\fB\-lysinemodified\ \fR\fB\fIinteger\fR\fR] [\fB\-disulphides\ \fR\fB\fIinteger\fR\fR] \fB\-step\ \fR\fB\fIfloat\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-report\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBiep\fR\ 'u +\fBiep\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBiep\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-amino\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-carboxyl\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-termini\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-lysinemodified\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-disulphides\fR \fIinteger\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-step\fR \fIfloat\fR +.RS 4 +Default value: \&.5 +.RE +.SS "Output section" +.PP +\fB\-plot\fR \fItoggle\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-report\fR \fItoggle\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +iep is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/demofeatures.1e +++ emboss-6.1.0/debian/manpages/demofeatures.1e @@ -0,0 +1,68 @@ +'\" t +.\" Title: DEMOFEATURES +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DEMOFEATURES" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +demofeatures \- Demonstration of the feature functions +.SH "SYNOPSIS" +.HP \w'\fBdemofeatures\fR\ 'u +\fBdemofeatures\fR \fB\-typesort\ \fR\fB\fIboolean\fR\fR \fB\-startsort\ \fR\fB\fIboolean\fR\fR \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR +.HP \w'\fBdemofeatures\fR\ 'u +\fBdemofeatures\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdemofeatures\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Advanced section" +.PP +\fB\-typesort\fR \fIboolean\fR +.RS 4 +Sort output features by their type Default value: N +.RE +.PP +\fB\-startsort\fR \fIboolean\fR +.RS 4 +Sort output features by their start position Default value: N +.RE +.SS "Output section" +.PP +\fB\-outfeat\fR \fIfeatout\fR +.RS 4 +File for output of normal tab delimited gff\'s Default value: gff:demofeatures\&.gff +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +demofeatures is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/maskseq.1e +++ emboss-6.1.0/debian/manpages/maskseq.1e @@ -0,0 +1,78 @@ +'\" t +.\" Title: MASKSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "MASKSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +maskseq \- Write a sequence with masked regions +.SH "SYNOPSIS" +.HP \w'\fBmaskseq\fR\ 'u +\fBmaskseq\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-regions\ \fR\fB\fIrange\fR\fR [\fB\-tolower\ \fR\fB\fItoggle\fR\fR] \fB\-maskchar\ \fR\fB\fIstring\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR +.HP \w'\fBmaskseq\fR\ 'u +\fBmaskseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBmaskseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-regions\fR \fIrange\fR +.RS 4 +Regions to mask\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are separated by any non\-digit, non\-alpha character\&. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765\&.\&.888 1,5,8,10,23,45,57,99 +.RE +.SS "Additional section" +.PP +\fB\-tolower\fR \fItoggle\fR +.RS 4 +The region can be \'masked\' by converting the sequence characters to lower\-case, some non\-EMBOSS programs e\&.g\&. fasta can interpret this as a masked region\&. The sequence is unchanged apart from the case change\&. You might like to ensure that the whole sequence is in upper\-case before masking the specified regions to lower\-case by using the \'\-supper\' flag\&. Default value: N +.RE +.PP +\fB\-maskchar\fR \fIstring\fR +.RS 4 +Character to use when masking\&. Default is \'X\' for protein sequences, \'N\' for nucleic sequences\&. If the mask character is set to be the SPACE character or a null character, then the sequence is \'masked\' by changing it to lower\-case, just as with the \'\-lowercase\' flag\&. Default value: @($(acdprotein)?X:N) +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +maskseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/geecee.1e +++ emboss-6.1.0/debian/manpages/geecee.1e @@ -0,0 +1,61 @@ +'\" t +.\" Title: GEECEE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "GEECEE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +geecee \- Calculate fractional GC content of nucleic acid sequences +.SH "SYNOPSIS" +.HP \w'\fBgeecee\fR\ 'u +\fBgeecee\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBgeecee\fR\ 'u +\fBgeecee\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBgeecee\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:CpG Islands" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +geecee is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/garnier.1e +++ emboss-6.1.0/debian/manpages/garnier.1e @@ -0,0 +1,67 @@ +'\" t +.\" Title: GARNIER +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "GARNIER" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +garnier \- Predicts protein secondary structure using GOR method +.SH "SYNOPSIS" +.HP \w'\fBgarnier\fR\ 'u +\fBgarnier\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-idc\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBgarnier\fR\ 'u +\fBgarnier\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBgarnier\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:2D Structure" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-idc\fR \fIinteger\fR +.RS 4 +In their paper, GOR mention that if you know something about the secondary structure content of the protein you are analyzing, you can do better in prediction\&. \'idc\' is an index into a set of arrays, dharr[] and dsarr[], which provide \'decision constants\' (dch, dcs), which are offsets that are applied to the weights for the helix and sheet (extend) terms\&. So, idc=0 says don\'t use the decision constant offsets, and idc=1 to 6 indicates that various combinations of dch,dcs offsets should be used\&. +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +garnier is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/polydot.1e +++ emboss-6.1.0/debian/manpages/polydot.1e @@ -0,0 +1,87 @@ +'\" t +.\" Title: POLYDOT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "POLYDOT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +polydot \- Draw dotplots for all\-against\-all comparison of a sequence set +.SH "SYNOPSIS" +.HP \w'\fBpolydot\fR\ 'u +\fBpolydot\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR \fB\-gap\ \fR\fB\fIinteger\fR\fR [\fB\-boxit\ \fR\fB\fIboolean\fR\fR] [\fB\-dumpfeat\ \fR\fB\fItoggle\fR\fR] \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR \fB\-graph\ \fR\fB\fIgraph\fR\fR +.HP \w'\fBpolydot\fR\ 'u +\fBpolydot\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBpolydot\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Dot plots" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequences\fR \fIseqset\fR +.RS 4 +File containing a sequence alignment +.RE +.SS "Required section" +.PP +\fB\-wordsize\fR \fIinteger\fR +.RS 4 +Default value: 6 +.RE +.SS "Output section" +.PP +\fB\-gap\fR \fIinteger\fR +.RS 4 +This specifies the size of the gap that is used to separate the individual dotplots in the display\&. The size is measured in residues, as displayed in the output\&. Default value: 10 +.RE +.PP +\fB\-boxit\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-dumpfeat\fR \fItoggle\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-outfeat\fR \fIfeatout\fR +.RS 4 +.RE +.PP +\fB\-graph\fR \fIgraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +polydot is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/prettyseq.1e +++ emboss-6.1.0/debian/manpages/prettyseq.1e @@ -0,0 +1,93 @@ +'\" t +.\" Title: PRETTYSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PRETTYSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +prettyseq \- Write a nucleotide sequence and its translation to file +.SH "SYNOPSIS" +.HP \w'\fBprettyseq\fR\ 'u +\fBprettyseq\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-range\ \fR\fB\fIrange\fR\fR [\fB\-table\ \fR\fB\fIlist\fR\fR] [\fB\-ruler\ \fR\fB\fIboolean\fR\fR] [\fB\-plabel\ \fR\fB\fIboolean\fR\fR] [\fB\-nlabel\ \fR\fB\fIboolean\fR\fR] \fB\-width\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBprettyseq\fR\ 'u +\fBprettyseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBprettyseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Nucleic:Translation" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-range\fR \fIrange\fR +.RS 4 +Default value: $(sequence\&.begin)\-$(sequence\&.end) +.RE +.SS "Additional section" +.PP +\fB\-table\fR \fIlist\fR +.RS 4 +.RE +.PP +\fB\-ruler\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-plabel\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-nlabel\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.SS "Advanced section" +.PP +\fB\-width\fR \fIinteger\fR +.RS 4 +Default value: 60 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +prettyseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/pepwindow.1e +++ emboss-6.1.0/debian/manpages/pepwindow.1e @@ -0,0 +1,77 @@ +'\" t +.\" Title: PEPWINDOW +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PEPWINDOW" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +pepwindow \- Draw a hydropathy plot for a protein sequence +.SH "SYNOPSIS" +.HP \w'\fBpepwindow\fR\ 'u +\fBpepwindow\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-datafile\ \fR\fB\fIdatafile\fR\fR] [\fB\-length\ \fR\fB\fIinteger\fR\fR] [\fB\-normalize\ \fR\fB\fIboolean\fR\fR] \fB\-graph\ \fR\fB\fIxygraph\fR\fR +.HP \w'\fBpepwindow\fR\ 'u +\fBpepwindow\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBpepwindow\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fIdatafile\fR +.RS 4 +Default value: Enakai\&.dat +.RE +.SS "Additional section" +.PP +\fB\-length\fR \fIinteger\fR +.RS 4 +Default value: 19 +.RE +.PP +\fB\-normalize\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +pepwindow is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/supermatcher.1e +++ emboss-6.1.0/debian/manpages/supermatcher.1e @@ -0,0 +1,97 @@ +'\" t +.\" Title: SUPERMATCHER +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SUPERMATCHER" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +supermatcher \- Calculate approximate local pair\-wise alignments of larger sequences +.SH "SYNOPSIS" +.HP \w'\fBsupermatcher\fR\ 'u +\fBsupermatcher\fR \fB\-asequence\ \fR\fB\fIseqall\fR\fR \fB\-bsequence\ \fR\fB\fIseqset\fR\fR [\fB\-datafile\ \fR\fB\fImatrixf\fR\fR] \fB\-gapopen\ \fR\fB\fIfloat\fR\fR \fB\-gapextend\ \fR\fB\fIfloat\fR\fR [\fB\-width\ \fR\fB\fIinteger\fR\fR] [\fB\-wordlen\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR [\fB\-errorfile\ \fR\fB\fIoutfile\fR\fR] +.HP \w'\fBsupermatcher\fR\ 'u +\fBsupermatcher\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBsupermatcher\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Local" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-asequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-bsequence\fR \fIseqset\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fImatrixf\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.SS "Required section" +.PP +\fB\-gapopen\fR \fIfloat\fR +.RS 4 +Default value: @($(acdprotein)? 10\&.0 : 10\&.0) +.RE +.PP +\fB\-gapextend\fR \fIfloat\fR +.RS 4 +Default value: @($(acdprotein)? 0\&.5 : 0\&.5) +.RE +.SS "Additional section" +.PP +\fB\-width\fR \fIinteger\fR +.RS 4 +Default value: 16 +.RE +.PP +\fB\-wordlen\fR \fIinteger\fR +.RS 4 +Default value: 6 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIalign\fR +.RS 4 +.RE +.PP +\fB\-errorfile\fR \fIoutfile\fR +.RS 4 +Error file to be written to Default value: supermatcher\&.error +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +supermatcher is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/aligncopy.1e +++ emboss-6.1.0/debian/manpages/aligncopy.1e @@ -0,0 +1,78 @@ +'\" t +.\" Title: ALIGNCOPY +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ALIGNCOPY" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +aligncopy \- Reads and writes alignments +.SH "SYNOPSIS" +.HP \w'\fBaligncopy\fR\ 'u +\fBaligncopy\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR [\fB\-name\ \fR\fB\fIstring\fR\fR] [\fB\-comment\ \fR\fB\fIstring\fR\fR] [\fB\-append\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR +.HP \w'\fBaligncopy\fR\ 'u +\fBaligncopy\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBaligncopy\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequences\fR \fIseqset\fR +.RS 4 +File containing a sequence alignment\&. +.RE +.SS "Required section" +.SS "Additional section" +.PP +\fB\-name\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-comment\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-append\fR \fIboolean\fR +.RS 4 +This allows you to append the name and comments you have given on to the end of the existing alignment header\&. Default value: N +.RE +.SS "Advanced section" +.SS "Output section" +.PP +\fB\-outfile\fR \fIalign\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +aligncopy is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/showorf.1e +++ emboss-6.1.0/debian/manpages/showorf.1e @@ -0,0 +1,92 @@ +'\" t +.\" Title: SHOWORF +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SHOWORF" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +showorf \- Display a nucleotide sequence and translation in pretty format +.SH "SYNOPSIS" +.HP \w'\fBshoworf\fR\ 'u +\fBshoworf\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-frames\ \fR\fB\fIlist\fR\fR [\fB\-table\ \fR\fB\fIlist\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR [\fB\-ruler\ \fR\fB\fIboolean\fR\fR] [\fB\-plabel\ \fR\fB\fIboolean\fR\fR] [\fB\-nlabel\ \fR\fB\fIboolean\fR\fR] \fB\-width\ \fR\fB\fIinteger\fR\fR +.HP \w'\fBshoworf\fR\ 'u +\fBshoworf\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBshoworf\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Gene finding,Nucleic:Translation" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-frames\fR \fIlist\fR +.RS 4 +Default value: 1,2,3,4,5,6 +.RE +.SS "Additional section" +.PP +\fB\-table\fR \fIlist\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-ruler\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-plabel\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-nlabel\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-width\fR \fIinteger\fR +.RS 4 +Default value: 50 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +showorf is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/demoalign.1e +++ emboss-6.1.0/debian/manpages/demoalign.1e @@ -0,0 +1,76 @@ +'\" t +.\" Title: DEMOALIGN +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DEMOALIGN" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +demoalign \- Reads a sequence set, writes an alignment file +.SH "SYNOPSIS" +.HP \w'\fBdemoalign\fR\ 'u +\fBdemoalign\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR [\fB\-floatmatrix\ \fR\fB\fImatrixf\fR\fR] [\fB\-intmatrix\ \fR\fB\fImatrix\fR\fR] \fB\-dofloat\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIalign\fR\fR +.HP \w'\fBdemoalign\fR\ 'u +\fBdemoalign\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdemoalign\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqset\fR +.RS 4 +.RE +.PP +\fB\-floatmatrix\fR \fImatrixf\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.PP +\fB\-intmatrix\fR \fImatrix\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.SS "Advanced section" +.PP +\fB\-dofloat\fR \fIboolean\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIalign\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +demoalign is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/extractseq.1e +++ emboss-6.1.0/debian/manpages/extractseq.1e @@ -0,0 +1,73 @@ +'\" t +.\" Title: EXTRACTSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "EXTRACTSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +extractseq \- Extract regions from a sequence +.SH "SYNOPSIS" +.HP \w'\fBextractseq\fR\ 'u +\fBextractseq\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-regions\ \fR\fB\fIrange\fR\fR [\fB\-separate\ \fR\fB\fIboolean\fR\fR] \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBextractseq\fR\ 'u +\fBextractseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBextractseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-regions\fR \fIrange\fR +.RS 4 +Regions to extract\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are separated by any non\-digit, non\-alpha character\&. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765\&.\&.888 1,5,8,10,23,45,57,99 Default value: $(sequence\&.begin)\-$(sequence\&.end) +.RE +.SS "Additional section" +.PP +\fB\-separate\fR \fIboolean\fR +.RS 4 +If this is set true then each specified region is written out as a separate sequence\&. The name of the sequence is created from the name of the original sequence with the start and end positions of the range appended with underscore characters between them, eg: XYZ region 2 to 34 is written as: XYZ_2_34 Default value: N +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +extractseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/sixpack.1e +++ emboss-6.1.0/debian/manpages/sixpack.1e @@ -0,0 +1,146 @@ +'\" t +.\" Title: SIXPACK +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SIXPACK" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +sixpack \- Display a DNA sequence with 6\-frame translation and ORFs +.SH "SYNOPSIS" +.HP \w'\fBsixpack\fR\ 'u +\fBsixpack\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-table\ \fR\fB\fIlist\fR\fR] [\fB\-firstorf\ \fR\fB\fIboolean\fR\fR] [\fB\-lastorf\ \fR\fB\fIboolean\fR\fR] [\fB\-mstart\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR \fB\-reverse\ \fR\fB\fIboolean\fR\fR \fB\-orfminsize\ \fR\fB\fIinteger\fR\fR \fB\-uppercase\ \fR\fB\fIrange\fR\fR \fB\-highlight\ \fR\fB\fIrange\fR\fR \fB\-number\ \fR\fB\fIboolean\fR\fR \fB\-width\ \fR\fB\fIinteger\fR\fR \fB\-length\ \fR\fB\fIinteger\fR\fR \fB\-margin\ \fR\fB\fIinteger\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR \fB\-offset\ \fR\fB\fIinteger\fR\fR \fB\-html\ \fR\fB\fIboolean\fR\fR +.HP \w'\fBsixpack\fR\ 'u +\fBsixpack\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBsixpack\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Nucleic:Gene finding,Nucleic:Translation" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-table\fR \fIlist\fR +.RS 4 +Genetics code used for the translation +.RE +.PP +\fB\-firstorf\fR \fIboolean\fR +.RS 4 +Count the beginning of a sequence as a possible ORF, even if it\'s inferior to the minimal ORF size\&. Default value: Y +.RE +.PP +\fB\-lastorf\fR \fIboolean\fR +.RS 4 +Count the end of a sequence as a possible ORF, even if it\'s not finishing with a STOP, or inferior to the minimal ORF size\&. Default value: Y +.RE +.PP +\fB\-mstart\fR \fIboolean\fR +.RS 4 +Displays only ORFs starting with an M\&. Default value: N +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +ORF sequence output +.RE +.PP +\fB\-reverse\fR \fIboolean\fR +.RS 4 +Display also the translation of the DNA sequence in the 3 reverse frames Default value: Y +.RE +.PP +\fB\-orfminsize\fR \fIinteger\fR +.RS 4 +Minimum size of Open Reading Frames (ORFs) to display in the translations\&. Default value: 1 +.RE +.PP +\fB\-uppercase\fR \fIrange\fR +.RS 4 +Regions to put in uppercase\&. If this is left blank, then the sequence case is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are separated by any non\-digit, non\-alpha character\&. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765\&.\&.888 1,5,8,10,23,45,57,99 +.RE +.PP +\fB\-highlight\fR \fIrange\fR +.RS 4 +Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \'@filename\'\&. +.RE +.PP +\fB\-number\fR \fIboolean\fR +.RS 4 +Number the sequence at the beginning and the end of each line\&. Default value: Y +.RE +.PP +\fB\-width\fR \fIinteger\fR +.RS 4 +Number of nucleotides displayed on each line Default value: 60 +.RE +.PP +\fB\-length\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-margin\fR \fIinteger\fR +.RS 4 +Default value: 10 +.RE +.PP +\fB\-name\fR \fIboolean\fR +.RS 4 +Set this to be false if you do not wish to display the ID name of the sequence\&. Default value: Y +.RE +.PP +\fB\-description\fR \fIboolean\fR +.RS 4 +Set this to be false if you do not wish to display the description of the sequence\&. Default value: Y +.RE +.PP +\fB\-offset\fR \fIinteger\fR +.RS 4 +Number from which you want the DNA sequence to be numbered\&. Default value: 1 +.RE +.PP +\fB\-html\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +sixpack is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/featreport.1e +++ emboss-6.1.0/debian/manpages/featreport.1e @@ -0,0 +1,65 @@ +'\" t +.\" Title: FEATREPORT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "FEATREPORT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +featreport \- Reads and writes a feature table +.SH "SYNOPSIS" +.HP \w'\fBfeatreport\fR\ 'u +\fBfeatreport\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-features\ \fR\fB\fIfeatures\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBfeatreport\fR\ 'u +\fBfeatreport\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBfeatreport\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-features\fR \fIfeatures\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +featreport is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/matcher.1e +++ emboss-6.1.0/debian/manpages/matcher.1e @@ -0,0 +1,86 @@ +'\" t +.\" Title: MATCHER +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "MATCHER" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +matcher \- Waterman\-Eggert local alignment of two sequences +.SH "SYNOPSIS" +.HP \w'\fBmatcher\fR\ 'u +\fBmatcher\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR [\fB\-datafile\ \fR\fB\fImatrix\fR\fR] [\fB\-alternatives\ \fR\fB\fIinteger\fR\fR] [\fB\-gapopen\ \fR\fB\fIinteger\fR\fR] [\fB\-gapextend\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR +.HP \w'\fBmatcher\fR\ 'u +\fBmatcher\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBmatcher\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Local" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-asequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-bsequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fImatrix\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.SS "Additional section" +.PP +\fB\-alternatives\fR \fIinteger\fR +.RS 4 +This sets the number of alternative matches output\&. By default only the highest scoring alignment is shown\&. A value of 2 gives you other reasonable alignments\&. In some cases, for example multidomain proteins of cDNA and genomic DNA comparisons, there may be other interesting and significant alignments\&. Default value: 1 +.RE +.PP +\fB\-gapopen\fR \fIinteger\fR +.RS 4 +The gap penalty is the score taken away when a gap is created\&. The best value depends on the choice of comparison matrix\&. The default value of 14 assumes you are using the EBLOSUM62 matrix for protein sequences, or a value of 16 and the EDNAFULL matrix for nucleotide sequences\&. Default value: @($(acdprotein)? 14 : 16) +.RE +.PP +\fB\-gapextend\fR \fIinteger\fR +.RS 4 +The gap length, or gap extension, penalty is added to the standard gap penalty for each base or residue in the gap\&. This is how long gaps are penalized\&. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty\&. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps\&. You can get this result by setting the gap penalty to zero (or very low) and using the gap extension penalty to control gap scoring\&. Default value: @($(acdprotein)? 4 : 4) +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIalign\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +matcher is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/equicktandem.1e +++ emboss-6.1.0/debian/manpages/equicktandem.1e @@ -0,0 +1,76 @@ +'\" t +.\" Title: EQUICKTANDEM +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "EQUICKTANDEM" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +equicktandem \- Finds tandem repeats in nucleotide sequences +.SH "SYNOPSIS" +.HP \w'\fBequicktandem\fR\ 'u +\fBequicktandem\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-maxrepeat\ \fR\fB\fIinteger\fR\fR \fB\-threshold\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR \fB\-origfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBequicktandem\fR\ 'u +\fBequicktandem\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBequicktandem\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Repeats" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-maxrepeat\fR \fIinteger\fR +.RS 4 +Default value: 600 +.RE +.PP +\fB\-threshold\fR \fIinteger\fR +.RS 4 +Default value: 20 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.PP +\fB\-origfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +equicktandem is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/trimseq.1e +++ emboss-6.1.0/debian/manpages/trimseq.1e @@ -0,0 +1,93 @@ +'\" t +.\" Title: TRIMSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "TRIMSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +trimseq \- Remove unwanted characters from start and end of sequence(s) +.SH "SYNOPSIS" +.HP \w'\fBtrimseq\fR\ 'u +\fBtrimseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-window\ \fR\fB\fIinteger\fR\fR] [\fB\-percent\ \fR\fB\fIfloat\fR\fR] [\fB\-strict\ \fR\fB\fIboolean\fR\fR] [\fB\-star\ \fR\fB\fIboolean\fR\fR] \fB\-left\ \fR\fB\fIboolean\fR\fR \fB\-right\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBtrimseq\fR\ 'u +\fBtrimseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBtrimseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-window\fR \fIinteger\fR +.RS 4 +This determines the size of the region that is considered when deciding whether the percentage of ambiguity is greater than the threshold\&. A value of 5 means that a region of 5 letters in the sequence is shifted along the sequence from the ends and trimming is done only if there is a greater or equal percentage of ambiguity than the threshold percentage\&. Default value: 1 +.RE +.PP +\fB\-percent\fR \fIfloat\fR +.RS 4 +This is the threshold of the percentage ambiguity in the window required in order to trim a sequence\&. Default value: 100\&.0 +.RE +.PP +\fB\-strict\fR \fIboolean\fR +.RS 4 +In nucleic sequences, trim off not only N\'s and X\'s, but also the nucleotide IUPAC ambiguity codes M, R, W, S, Y, K, V, H, D and B\&. In protein sequences, trim off not only X\'s but also B and Z\&. Default value: N +.RE +.PP +\fB\-star\fR \fIboolean\fR +.RS 4 +In protein sequences, trim off not only X\'s, but also the *\'s Default value: N +.RE +.SS "Advanced section" +.PP +\fB\-left\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-right\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +trimseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/est2genome.1e +++ emboss-6.1.0/debian/manpages/est2genome.1e @@ -0,0 +1,141 @@ +'\" t +.\" Title: EST2GENOME +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "EST2GENOME" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +est2genome \- Align EST sequences to genomic DNA sequence +.SH "SYNOPSIS" +.HP \w'\fBest2genome\fR\ 'u +\fBest2genome\fR \fB\-estsequence\ \fR\fB\fIseqall\fR\fR \fB\-genomesequence\ \fR\fB\fIsequence\fR\fR [\fB\-match\ \fR\fB\fIinteger\fR\fR] [\fB\-mismatch\ \fR\fB\fIinteger\fR\fR] [\fB\-gappenalty\ \fR\fB\fIinteger\fR\fR] [\fB\-intronpenalty\ \fR\fB\fIinteger\fR\fR] [\fB\-splicepenalty\ \fR\fB\fIinteger\fR\fR] [\fB\-minscore\ \fR\fB\fIinteger\fR\fR] \fB\-reverse\ \fR\fB\fIboolean\fR\fR \fB\-usesplice\ \fR\fB\fIboolean\fR\fR \fB\-mode\ \fR\fB\fIlist\fR\fR \fB\-best\ \fR\fB\fIboolean\fR\fR \fB\-space\ \fR\fB\fIfloat\fR\fR \fB\-shuffle\ \fR\fB\fIinteger\fR\fR \fB\-seed\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-align\ \fR\fB\fIboolean\fR\fR \fB\-width\ \fR\fB\fIinteger\fR\fR +.HP \w'\fBest2genome\fR\ 'u +\fBest2genome\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBest2genome\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Global" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-estsequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-genomesequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-match\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-mismatch\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-gappenalty\fR \fIinteger\fR +.RS 4 +Cost for deleting a single base in either sequence, excluding introns Default value: 2 +.RE +.PP +\fB\-intronpenalty\fR \fIinteger\fR +.RS 4 +Cost for an intron, independent of length\&. Default value: 40 +.RE +.PP +\fB\-splicepenalty\fR \fIinteger\fR +.RS 4 +Cost for an intron, independent of length and starting/ending on donor\-acceptor sites Default value: 20 +.RE +.PP +\fB\-minscore\fR \fIinteger\fR +.RS 4 +Exclude alignments with scores below this threshold score\&. Default value: 30 +.RE +.SS "Advanced section" +.PP +\fB\-reverse\fR \fIboolean\fR +.RS 4 +Reverse the orientation of the EST sequence +.RE +.PP +\fB\-usesplice\fR \fIboolean\fR +.RS 4 +Use donor and acceptor splice sites\&. If you want to ignore donor\-acceptor sites then set this to be false\&. Default value: Y +.RE +.PP +\fB\-mode\fR \fIlist\fR +.RS 4 +This determines the comparion mode\&. The default value is \'both\', in which case both strands of the est are compared assuming a forward gene direction (ie GT/AG splice sites), and the best comparsion redone assuming a reversed (CT/AC) gene splicing direction\&. The other allowed modes are \'forward\', when just the forward strand is searched, and \'reverse\', ditto for the reverse strand\&. Default value: both +.RE +.PP +\fB\-best\fR \fIboolean\fR +.RS 4 +You can print out all comparisons instead of just the best one by setting this to be false\&. Default value: Y +.RE +.PP +\fB\-space\fR \fIfloat\fR +.RS 4 +For linear\-space recursion\&. If product of sequence lengths divided by 4 exceeds this then a divide\-and\-conquer strategy is used to control the memory requirements\&. In this way very long sequences can be aligned\&. If you have a machine with plenty of memory you can raise this parameter (but do not exceed the machine\'s physical RAM) Default value: 10\&.0 +.RE +.PP +\fB\-shuffle\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-seed\fR \fIinteger\fR +.RS 4 +Default value: 20825 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-align\fR \fIboolean\fR +.RS 4 +Show the alignment\&. The alignment includes the first and last 5 bases of each intron, together with the intron width\&. The direction of splicing is indicated by angle brackets (forward or reverse) or ???? (unknown)\&. +.RE +.PP +\fB\-width\fR \fIinteger\fR +.RS 4 +Default value: 50 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +est2genome is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/pepnet.1e +++ emboss-6.1.0/debian/manpages/pepnet.1e @@ -0,0 +1,81 @@ +'\" t +.\" Title: PEPNET +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PEPNET" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +pepnet \- Draw a helical net for a protein sequence +.SH "SYNOPSIS" +.HP \w'\fBpepnet\fR\ 'u +\fBpepnet\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-amphipathic\ \fR\fB\fItoggle\fR\fR \fB\-squares\ \fR\fB\fIstring\fR\fR \fB\-diamonds\ \fR\fB\fIstring\fR\fR \fB\-octags\ \fR\fB\fIstring\fR\fR \fB\-graph\ \fR\fB\fIgraph\fR\fR +.HP \w'\fBpepnet\fR\ 'u +\fBpepnet\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBpepnet\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Protein:2D Structure" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-amphipathic\fR \fItoggle\fR +.RS 4 +If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked\&. This overrides any other markup that you may have specified using the qualifiers \'\-squares\', \'\-diamonds\' and \'\-octags\'\&. +.RE +.PP +\fB\-squares\fR \fIstring\fR +.RS 4 +By default the aliphatic residues ILVM are marked with squares\&. Default value: ILVM +.RE +.PP +\fB\-diamonds\fR \fIstring\fR +.RS 4 +By default the residues DENQST are marked with diamonds\&. Default value: DENQST +.RE +.PP +\fB\-octags\fR \fIstring\fR +.RS 4 +By default the positively charged residues HKR are marked with octagons\&. Default value: HKR +.RE +.PP +\fB\-graph\fR \fIgraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +pepnet is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/einverted.1e +++ emboss-6.1.0/debian/manpages/einverted.1e @@ -0,0 +1,93 @@ +'\" t +.\" Title: EINVERTED +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "EINVERTED" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +einverted \- Finds inverted repeats in nucleotide sequences +.SH "SYNOPSIS" +.HP \w'\fBeinverted\fR\ 'u +\fBeinverted\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-gap\ \fR\fB\fIinteger\fR\fR \fB\-threshold\ \fR\fB\fIinteger\fR\fR \fB\-match\ \fR\fB\fIinteger\fR\fR \fB\-mismatch\ \fR\fB\fIinteger\fR\fR [\fB\-maxrepeat\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR +.HP \w'\fBeinverted\fR\ 'u +\fBeinverted\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBeinverted\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Repeats,Nucleic:2D structure" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-gap\fR \fIinteger\fR +.RS 4 +Default value: 12 +.RE +.PP +\fB\-threshold\fR \fIinteger\fR +.RS 4 +Default value: 50 +.RE +.PP +\fB\-match\fR \fIinteger\fR +.RS 4 +Default value: 3 +.RE +.PP +\fB\-mismatch\fR \fIinteger\fR +.RS 4 +Default value: \-4 +.RE +.SS "Additional section" +.PP +\fB\-maxrepeat\fR \fIinteger\fR +.RS 4 +Maximum separation between the start of repeat and the end of the inverted repeat (the default is 2000 bases)\&. Default value: 2000 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +The sequence of the inverted repeat regions without gap characters\&. +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +einverted is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/newcoils.1e +++ emboss-6.1.0/debian/manpages/newcoils.1e @@ -0,0 +1,94 @@ +'\" t +.\" Title: NEWCOILS +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "NEWCOILS" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +newcoils \- Predicts coils protein secondary structure +.SH "SYNOPSIS" +.HP \w'\fBnewcoils\fR\ 'u +\fBnewcoils\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-datafile\ \fR\fB\fIdatafile\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-weighted\ \fR\fB\fIinteger\fR\fR \fB\-verb\ \fR\fB\fIinteger\fR\fR \fB\-mode\ \fR\fB\fIinteger\fR\fR \fB\-minseg\ \fR\fB\fIinteger\fR\fR \fB\-minp\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBnewcoils\fR\ 'u +\fBnewcoils\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBnewcoils\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:2D Structure" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fIdatafile\fR +.RS 4 +Default value: Enewcoils\&.mat +.RE +.SS "Required section" +.PP +\fB\-window\fR \fIinteger\fR +.RS 4 +Default value: 21 +.RE +.PP +\fB\-weighted\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-verb\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-mode\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-minseg\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-minp\fR \fIfloat\fR +.RS 4 +Default value: 0\&.50 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +newcoils is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/findkm.1e +++ emboss-6.1.0/debian/manpages/findkm.1e @@ -0,0 +1,71 @@ +'\" t +.\" Title: FINDKM +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "FINDKM" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +findkm \- Calculate and plot enzyme reaction data +.SH "SYNOPSIS" +.HP \w'\fBfindkm\fR\ 'u +\fBfindkm\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-plot\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-graphlb\ \fR\fB\fIxygraph\fR\fR +.HP \w'\fBfindkm\fR\ 'u +\fBfindkm\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBfindkm\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Enzyme Kinetics" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-plot\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-graphlb\fR \fIxygraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +findkm is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/corbatest.1e +++ emboss-6.1.0/debian/manpages/corbatest.1e @@ -0,0 +1,62 @@ +'\" t +.\" Title: CORBATEST +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CORBATEST" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +corbatest \- Test of EMBL corba retrieval +.SH "SYNOPSIS" +.HP \w'\fBcorbatest\fR\ 'u +\fBcorbatest\fR \fB\-entry\ \fR\fB\fIstring\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBcorbatest\fR\ 'u +\fBcorbatest\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBcorbatest\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-entry\fR \fIstring\fR +.RS 4 +Default value: hsfau +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +corbatest is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/newseq.1e +++ emboss-6.1.0/debian/manpages/newseq.1e @@ -0,0 +1,77 @@ +'\" t +.\" Title: NEWSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "NEWSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +newseq \- Create a sequence file from a typed\-in sequence +.SH "SYNOPSIS" +.HP \w'\fBnewseq\fR\ 'u +\fBnewseq\fR \fB\-name\ \fR\fB\fIstring\fR\fR \fB\-description\ \fR\fB\fIstring\fR\fR \fB\-type\ \fR\fB\fIlist\fR\fR \fB\-sequence\ \fR\fB\fIstring\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR +.HP \w'\fBnewseq\fR\ 'u +\fBnewseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBnewseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-name\fR \fIstring\fR +.RS 4 +The name of of the sequence should be a single word that you will use to identify the sequence\&. It should have no (or few) punctuation characters in it\&. +.RE +.PP +\fB\-description\fR \fIstring\fR +.RS 4 +Enter any description of the sequence that you require\&. +.RE +.PP +\fB\-type\fR \fIlist\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-sequence\fR \fIstring\fR +.RS 4 +The sequence itself\&. Because of the limitation of the operating system, you will only be able to type in a short sequence of (typically) 250 characters, or so\&. The keyboard will beep at you when you have reached this limit and you will not be able to press the RETURN/ENTER key until you have deleted a few characters\&. +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +newseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/seqretall.1e +++ emboss-6.1.0/debian/manpages/seqretall.1e @@ -0,0 +1,61 @@ +'\" t +.\" Title: SEQRETALL +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SEQRETALL" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +seqretall \- Reads and writes (returns) a set of sequences one at a time +.SH "SYNOPSIS" +.HP \w'\fBseqretall\fR\ 'u +\fBseqretall\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBseqretall\fR\ 'u +\fBseqretall\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBseqretall\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +seqretall is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/antigenic.1e +++ emboss-6.1.0/debian/manpages/antigenic.1e @@ -0,0 +1,67 @@ +'\" t +.\" Title: ANTIGENIC +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ANTIGENIC" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +antigenic \- Finds antigenic sites in proteins +.SH "SYNOPSIS" +.HP \w'\fBantigenic\fR\ 'u +\fBantigenic\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-minlen\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBantigenic\fR\ 'u +\fBantigenic\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBantigenic\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Motifs" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-minlen\fR \fIinteger\fR +.RS 4 +Default value: 6 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +antigenic is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/dbiblast.1e +++ emboss-6.1.0/debian/manpages/dbiblast.1e @@ -0,0 +1,130 @@ +'\" t +.\" Title: DBIBLAST +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DBIBLAST" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +dbiblast \- Index a BLAST database +.SH "SYNOPSIS" +.HP \w'\fBdbiblast\fR\ 'u +\fBdbiblast\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-seqtype\ \fR\fB\fIlist\fR\fR \fB\-blastversion\ \fR\fB\fIlist\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-sortoptions\ \fR\fB\fIstring\fR\fR \fB\-maxindex\ \fR\fB\fIinteger\fR\fR \fB\-systemsort\ \fR\fB\fIboolean\fR\fR \fB\-cleanup\ \fR\fB\fIboolean\fR\fR \fB\-sourcefile\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR +.HP \w'\fBdbiblast\fR\ 'u +\fBdbiblast\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdbiblast\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database indexing" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-dbname\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-directory\fR \fIdirectory\fR +.RS 4 +Default value: \&. +.RE +.PP +\fB\-filenames\fR \fIstring\fR +.RS 4 +Default value: $(dbname) +.RE +.SS "Required section" +.PP +\fB\-release\fR \fIstring\fR +.RS 4 +Default value: 0\&.0 +.RE +.PP +\fB\-date\fR \fIstring\fR +.RS 4 +Default value: 00/00/00 +.RE +.PP +\fB\-seqtype\fR \fIlist\fR +.RS 4 +Default value: unknown +.RE +.PP +\fB\-blastversion\fR \fIlist\fR +.RS 4 +Default value: unknown +.RE +.SS "Advanced section" +.PP +\fB\-fields\fR \fIlist\fR +.RS 4 +Default value: acc +.RE +.PP +\fB\-exclude\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-sortoptions\fR \fIstring\fR +.RS 4 +Sort options, typically \'\-T \&.\' to use current directory for work files and \'\-k 1,1\' to force GNU sort to use the first field Default value: \-T \&. \-k 1,1 +.RE +.PP +\fB\-maxindex\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-systemsort\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-cleanup\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-sourcefile\fR \fIboolean\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-indexoutdir\fR \fIoutdir\fR +.RS 4 +Default value: \&. +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +dbiblast is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/intconv.1e +++ emboss-6.1.0/debian/manpages/intconv.1e @@ -0,0 +1,61 @@ +'\" t +.\" Title: INTCONV +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "INTCONV" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +intconv \- Convert ints to ajints and longs to ajlongs +.SH "SYNOPSIS" +.HP \w'\fBintconv\fR\ 'u +\fBintconv\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBintconv\fR\ 'u +\fBintconv\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBintconv\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +intconv is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/wossname.1e +++ emboss-6.1.0/debian/manpages/wossname.1e @@ -0,0 +1,121 @@ +'\" t +.\" Title: WOSSNAME +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "WOSSNAME" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +wossname \- Finds programs by keywords in their short description +.SH "SYNOPSIS" +.HP \w'\fBwossname\fR\ 'u +\fBwossname\fR \fB\-search\ \fR\fB\fIstring\fR\fR [\fB\-explode\ \fR\fB\fIboolean\fR\fR] [\fB\-allmatch\ \fR\fB\fIboolean\fR\fR] [\fB\-showkeywords\ \fR\fB\fIboolean\fR\fR] \fB\-emboss\ \fR\fB\fIboolean\fR\fR \fB\-embassy\ \fR\fB\fIboolean\fR\fR \fB\-showembassy\ \fR\fB\fIstring\fR\fR \fB\-colon\ \fR\fB\fIboolean\fR\fR \fB\-gui\ \fR\fB\fIboolean\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fItoggle\fR\fR] [\fB\-groups\ \fR\fB\fIboolean\fR\fR] [\fB\-alphabetic\ \fR\fB\fIboolean\fR\fR] +.HP \w'\fBwossname\fR\ 'u +\fBwossname\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBwossname\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-search\fR \fIstring\fR +.RS 4 +Enter a word or words here and a case\-independent search for it will be made in the one\-line documentation, group names and keywords of all of the EMBOSS programs\&. If no keyword is specified, all programs will be listed\&. +.RE +.SS "Additional section" +.PP +\fB\-explode\fR \fIboolean\fR +.RS 4 +The groups that EMBOSS applications belong to have two forms, exploded and not exploded\&. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones\&. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: \'NAME1\', \'NAME2\', \'NAME1 NAME2\', NAME2 NAME1\'\&. The non\-expanded names are simply like: \'NAME1 NAME2\'\&. Default value: N +.RE +.PP +\fB\-allmatch\fR \fIboolean\fR +.RS 4 +By default, all words in the search string must match\&. This option searches for a match to any word in a list of possibilities Default value: Y +.RE +.PP +\fB\-showkeywords\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Advanced section" +.PP +\fB\-emboss\fR \fIboolean\fR +.RS 4 +If you use this option then EMBOSS program documentation will be searched\&. If this option is set to be false, then only the EMBASSY programs will be searched (if the \-embassy option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y +.RE +.PP +\fB\-embassy\fR \fIboolean\fR +.RS 4 +If you use this option then EMBASSY program documentation will be searched\&. If this option is set to be false, then only the EMBOSS programs will be searched (if the \-emboss option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y +.RE +.PP +\fB\-showembassy\fR \fIstring\fR +.RS 4 +If you use this option then this EMBASSY package program documentation will be searched\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme +.RE +.PP +\fB\-colon\fR \fIboolean\fR +.RS 4 +The groups that EMBOSS applications belong to up to two levels, for example the primary group \'ALIGNMENT\' has several sub\-groups, or second\-level groups, e\&.g\&.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE\&. To aid programs that parse the output of wossname that require the names of these subgroups, a colon \':\' will be placed between the first and second level of the group name if this option is true\&. Note: This does not apply if the group names have been exploded with the \'explode\' option\&. Default value: N +.RE +.PP +\fB\-gui\fR \fIboolean\fR +.RS 4 +This option is intended to help those who are designing Graphical User Interfaces to the EMBOSS applications\&. Some EMBOSS programs are inappropriate for running in a GUI, these include other menu programs and interactive editors\&. This option allows you to only report those programs that can be run from a GUI Default value: N +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +Default value: stdout +.RE +.SS "Html section" +.PP +\fB\-html\fR \fItoggle\fR +.RS 4 +If you are sending the output to a file, this will format it for displaying as a table in a WWW document\&. Default value: N +.RE +.PP +\fB\-groups\fR \fIboolean\fR +.RS 4 +If you use this option, then only the group names will output to the file Default value: N +.RE +.PP +\fB\-alphabetic\fR \fIboolean\fR +.RS 4 +If you use this option, then you will get a single list of the program names and descriptions instead of the programs being listed in their functional groups\&. Default value: N +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +wossname is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/maskambigprot.1e +++ emboss-6.1.0/debian/manpages/maskambigprot.1e @@ -0,0 +1,66 @@ +'\" t +.\" Title: MASKAMBIGPROT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "MASKAMBIGPROT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +maskambigprot \- Masks all ambiguity characters in protein sequences with X +.SH "SYNOPSIS" +.HP \w'\fBmaskambigprot\fR\ 'u +\fBmaskambigprot\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBmaskambigprot\fR\ 'u +\fBmaskambigprot\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBmaskambigprot\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-feature\fR \fIboolean\fR +.RS 4 +.RE +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Advanced section" +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +maskambigprot is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/entret.1e +++ emboss-6.1.0/debian/manpages/entret.1e @@ -0,0 +1,66 @@ +'\" t +.\" Title: ENTRET +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ENTRET" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +entret \- Retrieves sequence entries from flatfile databases and files +.SH "SYNOPSIS" +.HP \w'\fBentret\fR\ 'u +\fBentret\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-firstonly\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBentret\fR\ 'u +\fBentret\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBentret\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-firstonly\fR \fIboolean\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +entret is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/etandem.1e +++ emboss-6.1.0/debian/manpages/etandem.1e @@ -0,0 +1,90 @@ +'\" t +.\" Title: ETANDEM +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ETANDEM" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +etandem \- Finds tandem repeats in a nucleotide sequence +.SH "SYNOPSIS" +.HP \w'\fBetandem\fR\ 'u +\fBetandem\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-minrepeat\ \fR\fB\fIinteger\fR\fR \fB\-maxrepeat\ \fR\fB\fIinteger\fR\fR \fB\-threshold\ \fR\fB\fIinteger\fR\fR \fB\-mismatch\ \fR\fB\fIboolean\fR\fR \fB\-uniform\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR \fB\-origfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBetandem\fR\ 'u +\fBetandem\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBetandem\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Repeats" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-minrepeat\fR \fIinteger\fR +.RS 4 +Default value: 10 +.RE +.PP +\fB\-maxrepeat\fR \fIinteger\fR +.RS 4 +Default value: $(minrepeat) +.RE +.SS "Advanced section" +.PP +\fB\-threshold\fR \fIinteger\fR +.RS 4 +Default value: 20 +.RE +.PP +\fB\-mismatch\fR \fIboolean\fR +.RS 4 +.RE +.PP +\fB\-uniform\fR \fIboolean\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.PP +\fB\-origfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +etandem is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/psiphi.1e +++ emboss-6.1.0/debian/manpages/psiphi.1e @@ -0,0 +1,78 @@ +'\" t +.\" Title: PSIPHI +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PSIPHI" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +psiphi \- Calculates phi and psi torsion angles from protein coordinates +.SH "SYNOPSIS" +.HP \w'\fBpsiphi\fR\ 'u +\fBpsiphi\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-chainnumber\ \fR\fB\fIinteger\fR\fR \fB\-startresiduenumber\ \fR\fB\fIinteger\fR\fR \fB\-finishresiduenumber\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBpsiphi\fR\ 'u +\fBpsiphi\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBpsiphi\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "protein:3D structure" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-chainnumber\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-startresiduenumber\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-finishresiduenumber\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.SS "Advanced section" +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +psiphi is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/cpgplot.1e +++ emboss-6.1.0/debian/manpages/cpgplot.1e @@ -0,0 +1,112 @@ +'\" t +.\" Title: CPGPLOT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CPGPLOT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +cpgplot \- Identify and plot CpG islands in nucleotide sequence(s) +.SH "SYNOPSIS" +.HP \w'\fBcpgplot\fR\ 'u +\fBcpgplot\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-minlen\ \fR\fB\fIinteger\fR\fR \fB\-minoe\ \fR\fB\fIfloat\fR\fR \fB\-minpc\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-obsexp\ \fR\fB\fIboolean\fR\fR \fB\-cg\ \fR\fB\fIboolean\fR\fR \fB\-pc\ \fR\fB\fIboolean\fR\fR \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR +.HP \w'\fBcpgplot\fR\ 'u +\fBcpgplot\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBcpgplot\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:CpG Islands" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-window\fR \fIinteger\fR +.RS 4 +The percentage CG content and the Observed frequency of CG is calculated within a window whose size is set by this parameter\&. The window is moved down the sequence and these statistics are calculated at each postition that the window is moved to\&. Default value: 100 +.RE +.PP +\fB\-minlen\fR \fIinteger\fR +.RS 4 +This sets the minimum length that a CpG island has to be before it is reported\&. Default value: 200 +.RE +.PP +\fB\-minoe\fR \fIfloat\fR +.RS 4 +This sets the minimum average observed to expected ratio of C plus G to CpG in a set of 10 windows that are required before a CpG island is reported\&. Default value: 0\&.6 +.RE +.PP +\fB\-minpc\fR \fIfloat\fR +.RS 4 +This sets the minimum average percentage of G plus C a set of 10 windows that are required before a CpG island is reported\&. Default value: 50\&. +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +This sets the name of the file holding the report of the input sequence name, CpG island parameters and the output details of any CpG islands that are found\&. +.RE +.PP +\fB\-plot\fR \fItoggle\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.PP +\fB\-obsexp\fR \fIboolean\fR +.RS 4 +If this is set to true then the graph of the observed to expected ratio of C plus G to CpG within a window is displayed\&. Default value: Y +.RE +.PP +\fB\-cg\fR \fIboolean\fR +.RS 4 +If this is set to true then the graph of the regions which have been determined to be CpG islands is displayed\&. Default value: Y +.RE +.PP +\fB\-pc\fR \fIboolean\fR +.RS 4 +If this is set to true then the graph of the percentage C plus G within a window is displayed\&. Default value: Y +.RE +.PP +\fB\-outfeat\fR \fIfeatout\fR +.RS 4 +File for output features +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +cpgplot is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/digest.1e +++ emboss-6.1.0/debian/manpages/digest.1e @@ -0,0 +1,103 @@ +'\" t +.\" Title: DIGEST +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DIGEST" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +digest \- Reports on protein proteolytic enzyme or reagent cleavage sites +.SH "SYNOPSIS" +.HP \w'\fBdigest\fR\ 'u +\fBdigest\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-mwdata\ \fR\fB\fIdatafile\fR\fR \fB\-menu\ \fR\fB\fIlist\fR\fR \fB\-mono\ \fR\fB\fIboolean\fR\fR \fB\-unfavoured\ \fR\fB\fIboolean\fR\fR \fB\-ragging\ \fR\fB\fIboolean\fR\fR \fB\-termini\ \fR\fB\fIlist\fR\fR \fB\-overlap\ \fR\fB\fIboolean\fR\fR \fB\-allpartials\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBdigest\fR\ 'u +\fBdigest\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdigest\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Motifs" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-seqall\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-mwdata\fR \fIdatafile\fR +.RS 4 +Molecular weight data for amino acids Default value: Emolwt\&.dat +.RE +.SS "Required section" +.PP +\fB\-menu\fR \fIlist\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-mono\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Advanced section" +.PP +\fB\-unfavoured\fR \fIboolean\fR +.RS 4 +Trypsin will not normally cut after \'KR\' if they are followed by any of \'KRIFLP\'\&. Lys\-C will not normally cut after \'K\' if it is followed by \'P\'\&. Arg\-C will not normally cut after \'R\' if it is followed by \'P\'\&. V8\-bicarb will not normally cut after \'E\' if it is followed by any of \'KREP\'\&. V8\-phosph will not normally cut after \'DE\' if they are followed by \'P\'\&. Chymotrypsin will not normally cut after \'FYWLM\' if they are followed by \'P\'\&. Specifying unfavoured shows these unfavoured cuts as well as the favoured ones\&. +.RE +.PP +\fB\-ragging\fR \fIboolean\fR +.RS 4 +Allows semi\-specific and non\-specific digestion\&. This option is particularly useful for generating lists of peptide sequences for protein identification using mass\-spectrometry\&. +.RE +.PP +\fB\-termini\fR \fIlist\fR +.RS 4 +Default value: 1 +.RE +.SS "Output section" +.PP +\fB\-overlap\fR \fIboolean\fR +.RS 4 +Used for partial digestion\&. Shows all cuts from favoured cut sites plus 1\&.\&.3, 2\&.\&.4, 3\&.\&.5 etc but not (e\&.g\&.) 2\&.\&.5\&. Overlaps are therefore fragments with exactly one potential cut site within it\&. +.RE +.PP +\fB\-allpartials\fR \fIboolean\fR +.RS 4 +As for overlap but fragments containing more than one potential cut site are included\&. +.RE +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +digest is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/acdpretty.1e +++ emboss-6.1.0/debian/manpages/acdpretty.1e @@ -0,0 +1,51 @@ +'\" t +.\" Title: ACDPRETTY +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ACDPRETTY" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +acdpretty \- Correctly reformat an application ACD file +.SH "SYNOPSIS" +.HP \w'\fBacdpretty\fR\ 'u +\fBacdpretty\fR +.HP \w'\fBacdpretty\fR\ 'u +\fBacdpretty\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBacdpretty\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd" command group(s)\&. +.SH "OPTIONS" +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +acdpretty is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/jaspscan.1e +++ emboss-6.1.0/debian/manpages/jaspscan.1e @@ -0,0 +1,88 @@ +'\" t +.\" Title: JASPSCAN +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "JASPSCAN" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +jaspscan \- Scans DNA sequences for transcription factors +.SH "SYNOPSIS" +.HP \w'\fBjaspscan\fR\ 'u +\fBjaspscan\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-menu\ \fR\fB\fIlist\fR\fR \fB\-matrices\ \fR\fB\fIstring\fR\fR \fB\-threshold\ \fR\fB\fIfloat\fR\fR [\fB\-exclude\ \fR\fB\fIstring\fR\fR] [\fB\-both\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBjaspscan\fR\ 'u +\fBjaspscan\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBjaspscan\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Transcription" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-menu\fR \fIlist\fR +.RS 4 +Default value: C +.RE +.PP +\fB\-matrices\fR \fIstring\fR +.RS 4 +The name \'all\' reads in all matrix files from the selected JASPAR matrix set\&. You can specify individual matrices by giving their names with commas between then, such as: \'ma0001,ma0015\'\&. The case of the names is not important\&. You can specify a file of matrix names to read in by giving the name of the file holding the matrix names with a \'@\' character in front of it, for example, \'@matrix\&.list\'\&. Blank lines and lines starting with a hash character or \'!\' are ignored and all other lines are concatenated together with a comma character \',\' and then treated as the list of enzymes to search for\&. An example of a file of matrix names is: ! my matrices ma0001, ma0002 ! other matrices ma0010 ma0032 ma0053 Default value: all +.RE +.SS "Required section" +.PP +\fB\-threshold\fR \fIfloat\fR +.RS 4 +If the matrix score is greater than or equal to this percentage then a hit will be reported Default value: 80\&.0 +.RE +.SS "Additional section" +.PP +\fB\-exclude\fR \fIstring\fR +.RS 4 +The names of any matrices to exclude from the \'matrices\' list\&. Matrices are specified in the same way as for the selection list\&. +.RE +.PP +\fB\-both\fR \fIboolean\fR +.RS 4 +If set then both the forward and reverse strands are searched Default value: N +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +jaspscan is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/hmoment.1e +++ emboss-6.1.0/debian/manpages/hmoment.1e @@ -0,0 +1,97 @@ +'\" t +.\" Title: HMOMENT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "HMOMENT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +hmoment \- Calculate and plot hydrophobic moment for protein sequence(s) +.SH "SYNOPSIS" +.HP \w'\fBhmoment\fR\ 'u +\fBhmoment\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR [\fB\-window\ \fR\fB\fIinteger\fR\fR] [\fB\-aangle\ \fR\fB\fIinteger\fR\fR] [\fB\-bangle\ \fR\fB\fIinteger\fR\fR] \fB\-baseline\ \fR\fB\fIfloat\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-double\ \fR\fB\fIboolean\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBhmoment\fR\ 'u +\fBhmoment\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBhmoment\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:2D Structure" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-seqall\fR \fIseqall\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-window\fR \fIinteger\fR +.RS 4 +Default value: 10 +.RE +.PP +\fB\-aangle\fR \fIinteger\fR +.RS 4 +Default value: 100 +.RE +.PP +\fB\-bangle\fR \fIinteger\fR +.RS 4 +Default value: 160 +.RE +.SS "Advanced section" +.PP +\fB\-baseline\fR \fIfloat\fR +.RS 4 +Default value: 0\&.35 +.RE +.SS "Output section" +.PP +\fB\-plot\fR \fItoggle\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-double\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +hmoment is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/wordfinder.1e +++ emboss-6.1.0/debian/manpages/wordfinder.1e @@ -0,0 +1,113 @@ +'\" t +.\" Title: WORDFINDER +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "WORDFINDER" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +wordfinder \- Match large sequences against one or more other sequences +.SH "SYNOPSIS" +.HP \w'\fBwordfinder\fR\ 'u +\fBwordfinder\fR \fB\-asequence\ \fR\fB\fIseqset\fR\fR \fB\-bsequence\ \fR\fB\fIseqall\fR\fR [\fB\-datafile\ \fR\fB\fImatrixf\fR\fR] \fB\-gapopen\ \fR\fB\fIfloat\fR\fR \fB\-gapextend\ \fR\fB\fIfloat\fR\fR [\fB\-width\ \fR\fB\fIinteger\fR\fR] [\fB\-wordlen\ \fR\fB\fIinteger\fR\fR] [\fB\-limitmatch\ \fR\fB\fIinteger\fR\fR] [\fB\-limitalign\ \fR\fB\fIinteger\fR\fR] [\fB\-lowmatch\ \fR\fB\fIinteger\fR\fR] [\fB\-lowalign\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR [\fB\-errorfile\ \fR\fB\fIoutfile\fR\fR] +.HP \w'\fBwordfinder\fR\ 'u +\fBwordfinder\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBwordfinder\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Local" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-asequence\fR \fIseqset\fR +.RS 4 +.RE +.PP +\fB\-bsequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fImatrixf\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.SS "Required section" +.PP +\fB\-gapopen\fR \fIfloat\fR +.RS 4 +Default value: @($(acdprotein)? 30\&.0 : 30\&.0) +.RE +.PP +\fB\-gapextend\fR \fIfloat\fR +.RS 4 +Default value: @($(acdprotein)? 1\&.5 : 1\&.5) +.RE +.SS "Additional section" +.PP +\fB\-width\fR \fIinteger\fR +.RS 4 +Default value: 16 +.RE +.PP +\fB\-wordlen\fR \fIinteger\fR +.RS 4 +Default value: 6 +.RE +.PP +\fB\-limitmatch\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-limitalign\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-lowmatch\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-lowalign\fR \fIinteger\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIalign\fR +.RS 4 +.RE +.PP +\fB\-errorfile\fR \fIoutfile\fR +.RS 4 +Error file to be written to Default value: wordfinder\&.error +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +wordfinder is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/infobase.1e +++ emboss-6.1.0/debian/manpages/infobase.1e @@ -0,0 +1,65 @@ +'\" t +.\" Title: INFOBASE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "INFOBASE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +infobase \- Return information on a given nucleotide base +.SH "SYNOPSIS" +.HP \w'\fBinfobase\fR\ 'u +\fBinfobase\fR \fB\-code\ \fR\fB\fIstring\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBinfobase\fR\ 'u +\fBinfobase\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBinfobase\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-code\fR \fIstring\fR +.RS 4 +Enter IUPAC nucleotide base codes, e\&.g\&. A, C, G, T, R, Y etc\&. Default value: ABCDGHKMNRSTUVWXY +.RE +.SS "Required section" +.SS "Additional section" +.SS "Advanced section" +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +infobase is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/embossversion.1e +++ emboss-6.1.0/debian/manpages/embossversion.1e @@ -0,0 +1,62 @@ +'\" t +.\" Title: EMBOSSVERSION +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "EMBOSSVERSION" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +embossversion \- Reports the current EMBOSS version number +.SH "SYNOPSIS" +.HP \w'\fBembossversion\fR\ 'u +\fBembossversion\fR [\fB\-full\ \fR\fB\fIboolean\fR\fR] [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] +.HP \w'\fBembossversion\fR\ 'u +\fBembossversion\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBembossversion\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&. +.SH "OPTIONS" +.SS "Additional section" +.PP +\fB\-full\fR \fIboolean\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +Default value: stdout +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +embossversion is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/primersearch.1e +++ emboss-6.1.0/debian/manpages/primersearch.1e @@ -0,0 +1,70 @@ +'\" t +.\" Title: PRIMERSEARCH +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PRIMERSEARCH" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +primersearch \- Search DNA sequences for matches with primer pairs +.SH "SYNOPSIS" +.HP \w'\fBprimersearch\fR\ 'u +\fBprimersearch\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-mismatchpercent\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBprimersearch\fR\ 'u +\fBprimersearch\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBprimersearch\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Primers" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-seqall\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-mismatchpercent\fR \fIinteger\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +primersearch is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/seqretset.1e +++ emboss-6.1.0/debian/manpages/seqretset.1e @@ -0,0 +1,65 @@ +'\" t +.\" Title: SEQRETSET +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SEQRETSET" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +seqretset \- Reads and writes (returns) a set of sequences all at once +.SH "SYNOPSIS" +.HP \w'\fBseqretset\fR\ 'u +\fBseqretset\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR \fB\-outseq\ \fR\fB\fIseqoutset\fR\fR +.HP \w'\fBseqretset\fR\ 'u +\fBseqretset\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBseqretset\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-feature\fR \fIboolean\fR +.RS 4 +.RE +.PP +\fB\-sequence\fR \fIseqset\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutset\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +seqretset is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/wobble.1e +++ emboss-6.1.0/debian/manpages/wobble.1e @@ -0,0 +1,77 @@ +'\" t +.\" Title: WOBBLE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "WOBBLE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +wobble \- Plot third base position variability in a nucleotide sequence +.SH "SYNOPSIS" +.HP \w'\fBwobble\fR\ 'u +\fBwobble\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-window\ \fR\fB\fIinteger\fR\fR] \fB\-bases\ \fR\fB\fIstring\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBwobble\fR\ 'u +\fBwobble\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBwobble\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Gene finding" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-window\fR \fIinteger\fR +.RS 4 +Default value: 30 +.RE +.SS "Advanced section" +.PP +\fB\-bases\fR \fIstring\fR +.RS 4 +Default value: GC +.RE +.SS "Output section" +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +wobble is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/listor.1e +++ emboss-6.1.0/debian/manpages/listor.1e @@ -0,0 +1,72 @@ +'\" t +.\" Title: LISTOR +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "LISTOR" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +listor \- Write a list file of the logical OR of two sets of sequences +.SH "SYNOPSIS" +.HP \w'\fBlistor\fR\ 'u +\fBlistor\fR \fB\-firstsequences\ \fR\fB\fIseqset\fR\fR \fB\-secondsequences\ \fR\fB\fIseqset\fR\fR [\fB\-operator\ \fR\fB\fIlist\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBlistor\fR\ 'u +\fBlistor\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBlistor\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-firstsequences\fR \fIseqset\fR +.RS 4 +.RE +.PP +\fB\-secondsequences\fR \fIseqset\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-operator\fR \fIlist\fR +.RS 4 +The following logical operators combine the sequences in the following ways: OR \- gives all that occur in one set or the other AND \- gives only those which occur in both sets XOR \- gives those which only occur in one set or the other, but not in both NOT \- gives those which occur in the first set except for those that also occur in the second Default value: OR +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +The list of sequence names will be written to this list file +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +listor is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/pepwheel.1e +++ emboss-6.1.0/debian/manpages/pepwheel.1e @@ -0,0 +1,97 @@ +'\" t +.\" Title: PEPWHEEL +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PEPWHEEL" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +pepwheel \- Draw a helical wheel diagram for a protein sequence +.SH "SYNOPSIS" +.HP \w'\fBpepwheel\fR\ 'u +\fBpepwheel\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-wheel\ \fR\fB\fIboolean\fR\fR [\fB\-steps\ \fR\fB\fIinteger\fR\fR] [\fB\-turns\ \fR\fB\fIinteger\fR\fR] \fB\-graph\ \fR\fB\fIgraph\fR\fR \fB\-amphipathic\ \fR\fB\fItoggle\fR\fR \fB\-squares\ \fR\fB\fIstring\fR\fR \fB\-diamonds\ \fR\fB\fIstring\fR\fR \fB\-octags\ \fR\fB\fIstring\fR\fR +.HP \w'\fBpepwheel\fR\ 'u +\fBpepwheel\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBpepwheel\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Protein:2D Structure" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-wheel\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-steps\fR \fIinteger\fR +.RS 4 +The number of residues plotted per turn is this value divided by the \'turns\' value\&. Default value: 18 +.RE +.PP +\fB\-turns\fR \fIinteger\fR +.RS 4 +The number of residues plotted per turn is the \'steps\' value divided by this value\&. Default value: 5 +.RE +.PP +\fB\-graph\fR \fIgraph\fR +.RS 4 +.RE +.SS "Markup section" +.PP +\fB\-amphipathic\fR \fItoggle\fR +.RS 4 +If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked\&. This overrides any other markup that you may have specified using the qualifiers \'\-squares\', \'\-diamonds\' and \'\-octags\'\&. +.RE +.PP +\fB\-squares\fR \fIstring\fR +.RS 4 +By default the aliphatic residues ILVM are marked with squares\&. Default value: ILVM +.RE +.PP +\fB\-diamonds\fR \fIstring\fR +.RS 4 +By default the residues DENQST are marked with diamonds\&. Default value: DENQST +.RE +.PP +\fB\-octags\fR \fIstring\fR +.RS 4 +By default the positively charged residues HKR are marked with octagons\&. Default value: HKR +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +pepwheel is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/mwfilter.1e +++ emboss-6.1.0/debian/manpages/mwfilter.1e @@ -0,0 +1,78 @@ +'\" t +.\" Title: MWFILTER +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "MWFILTER" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +mwfilter \- Filter noisy data from molecular weights file +.SH "SYNOPSIS" +.HP \w'\fBmwfilter\fR\ 'u +\fBmwfilter\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-datafile\ \fR\fB\fIdatafile\fR\fR \fB\-tolerance\ \fR\fB\fIfloat\fR\fR [\fB\-showdel\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBmwfilter\fR\ 'u +\fBmwfilter\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBmwfilter\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fIdatafile\fR +.RS 4 +Default value: Emwfilter\&.dat +.RE +.SS "Required section" +.PP +\fB\-tolerance\fR \fIfloat\fR +.RS 4 +Default value: 50\&.0 +.RE +.SS "Additional section" +.PP +\fB\-showdel\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +mwfilter is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/aligncopypair.1e +++ emboss-6.1.0/debian/manpages/aligncopypair.1e @@ -0,0 +1,78 @@ +'\" t +.\" Title: ALIGNCOPYPAIR +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ALIGNCOPYPAIR" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +aligncopypair \- Reads and writes pairs from alignments +.SH "SYNOPSIS" +.HP \w'\fBaligncopypair\fR\ 'u +\fBaligncopypair\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR [\fB\-name\ \fR\fB\fIstring\fR\fR] [\fB\-comment\ \fR\fB\fIstring\fR\fR] [\fB\-append\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR +.HP \w'\fBaligncopypair\fR\ 'u +\fBaligncopypair\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBaligncopypair\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequences\fR \fIseqset\fR +.RS 4 +File containing a sequence alignment\&. +.RE +.SS "Required section" +.SS "Additional section" +.PP +\fB\-name\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-comment\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-append\fR \fIboolean\fR +.RS 4 +This allows you to append the name and comments you have given on to the end of the existing alignment header\&. Default value: N +.RE +.SS "Advanced section" +.SS "Output section" +.PP +\fB\-outfile\fR \fIalign\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +aligncopypair is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/histogramtest.1e +++ emboss-6.1.0/debian/manpages/histogramtest.1e @@ -0,0 +1,81 @@ +'\" t +.\" Title: HISTOGRAMTEST +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "HISTOGRAMTEST" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +histogramtest \- Test of graphics +.SH "SYNOPSIS" +.HP \w'\fBhistogramtest\fR\ 'u +\fBhistogramtest\fR \fB\-sets\ \fR\fB\fIinteger\fR\fR \fB\-points\ \fR\fB\fIinteger\fR\fR \fB\-bins\ \fR\fB\fIinteger\fR\fR \fB\-xstart\ \fR\fB\fIinteger\fR\fR \fB\-xend\ \fR\fB\fIinteger\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR +.HP \w'\fBhistogramtest\fR\ 'u +\fBhistogramtest\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBhistogramtest\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sets\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-points\fR \fIinteger\fR +.RS 4 +Default value: 10 +.RE +.PP +\fB\-bins\fR \fIinteger\fR +.RS 4 +Default value: $(points) +.RE +.PP +\fB\-xstart\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-xend\fR \fIinteger\fR +.RS 4 +Default value: @($(xstart)+$(points)) +.RE +.SS "Output section" +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +histogramtest is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/cons.1e +++ emboss-6.1.0/debian/manpages/cons.1e @@ -0,0 +1,87 @@ +'\" t +.\" Title: CONS +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CONS" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +cons \- Create a consensus sequence from a multiple alignment +.SH "SYNOPSIS" +.HP \w'\fBcons\fR\ 'u +\fBcons\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR [\fB\-datafile\ \fR\fB\fImatrix\fR\fR] [\fB\-plurality\ \fR\fB\fIfloat\fR\fR] [\fB\-identity\ \fR\fB\fIinteger\fR\fR] [\fB\-setcase\ \fR\fB\fIfloat\fR\fR] \fB\-outseq\ \fR\fB\fIseqout\fR\fR [\fB\-name\ \fR\fB\fIstring\fR\fR] +.HP \w'\fBcons\fR\ 'u +\fBcons\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBcons\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Consensus" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqset\fR +.RS 4 +File containing a sequence alignment\&. +.RE +.PP +\fB\-datafile\fR \fImatrix\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.SS "Additional section" +.PP +\fB\-plurality\fR \fIfloat\fR +.RS 4 +Set a cut\-off for the number of positive matches below which there is no consensus\&. The default plurality is taken as half the total weight of all the sequences in the alignment\&. Default value: @( $(sequence\&.totweight) / 2) +.RE +.PP +\fB\-identity\fR \fIinteger\fR +.RS 4 +Provides the facility of setting the required number of identities at a site for it to give a consensus at that position\&. Therefore, if this is set to the number of sequences in the alignment only columns of identities contribute to the consensus\&. +.RE +.PP +\fB\-setcase\fR \fIfloat\fR +.RS 4 +Sets the threshold for the positive matches above which the consensus is is upper\-case and below which the consensus is in lower\-case\&. Default value: @( $(sequence\&.totweight) / 2) +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +.RE +.PP +\fB\-name\fR \fIstring\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +cons is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/giep.1e +++ emboss-6.1.0/debian/manpages/giep.1e @@ -0,0 +1,91 @@ +'\" t +.\" Title: GIEP +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "GIEP" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +giep \- Calculates the isoelectric point of a protein +.SH "SYNOPSIS" +.HP \w'\fBgiep\fR\ 'u +\fBgiep\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-step\ \fR\fB\fIfloat\fR\fR \fB\-amino\ \fR\fB\fIinteger\fR\fR \fB\-termini\ \fR\fB\fIboolean\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-report\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBgiep\fR\ 'u +\fBgiep\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBgiep\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-step\fR \fIfloat\fR +.RS 4 +Default value: \&.5 +.RE +.PP +\fB\-amino\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-termini\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.SS "Output section" +.PP +\fB\-plot\fR \fItoggle\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-report\fR \fItoggle\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +giep is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/cirdna.1e +++ emboss-6.1.0/debian/manpages/cirdna.1e @@ -0,0 +1,158 @@ +'\" t +.\" Title: CIRDNA +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CIRDNA" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +cirdna \- Draws circular maps of DNA constructs +.SH "SYNOPSIS" +.HP \w'\fBcirdna\fR\ 'u +\fBcirdna\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR [\fB\-maxgroups\ \fR\fB\fIinteger\fR\fR] [\fB\-maxlabels\ \fR\fB\fIinteger\fR\fR] \fB\-ruler\ \fR\fB\fIboolean\fR\fR \fB\-blocktype\ \fR\fB\fIlist\fR\fR [\fB\-originangle\ \fR\fB\fIfloat\fR\fR] \fB\-posticks\ \fR\fB\fIselection\fR\fR \fB\-posblocks\ \fR\fB\fIselection\fR\fR [\fB\-intersymbol\ \fR\fB\fIboolean\fR\fR] [\fB\-intercolour\ \fR\fB\fIinteger\fR\fR] [\fB\-interticks\ \fR\fB\fIboolean\fR\fR] [\fB\-gapsize\ \fR\fB\fIinteger\fR\fR] [\fB\-ticklines\ \fR\fB\fIboolean\fR\fR] [\fB\-textheight\ \fR\fB\fIfloat\fR\fR] [\fB\-textlength\ \fR\fB\fIfloat\fR\fR] [\fB\-tickheight\ \fR\fB\fIfloat\fR\fR] [\fB\-blockheight\ \fR\fB\fIfloat\fR\fR] [\fB\-rangeheight\ \fR\fB\fIfloat\fR\fR] [\fB\-gapgroup\ \fR\fB\fIfloat\fR\fR] [\fB\-postext\ \fR\fB\fIfloat\fR\fR] \fB\-graphout\ \fR\fB\fIgraph\fR\fR +.HP \w'\fBcirdna\fR\ 'u +\fBcirdna\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBcirdna\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +Default value: inputfile +.RE +.SS "Additional section" +.PP +\fB\-maxgroups\fR \fIinteger\fR +.RS 4 +Default value: 20 +.RE +.PP +\fB\-maxlabels\fR \fIinteger\fR +.RS 4 +Default value: 10000 +.RE +.SS "Output section" +.PP +\fB\-ruler\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-blocktype\fR \fIlist\fR +.RS 4 +Default value: Filled +.RE +.PP +\fB\-originangle\fR \fIfloat\fR +.RS 4 +Default value: 90 +.RE +.PP +\fB\-posticks\fR \fIselection\fR +.RS 4 +Default value: Out +.RE +.PP +\fB\-posblocks\fR \fIselection\fR +.RS 4 +Default value: In +.RE +.PP +\fB\-intersymbol\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-intercolour\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-interticks\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-gapsize\fR \fIinteger\fR +.RS 4 +Default value: 500 +.RE +.PP +\fB\-ticklines\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-textheight\fR \fIfloat\fR +.RS 4 +Height of text\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-textlength\fR \fIfloat\fR +.RS 4 +Length of text\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-tickheight\fR \fIfloat\fR +.RS 4 +Height of ticks\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-blockheight\fR \fIfloat\fR +.RS 4 +Height of blocks\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-rangeheight\fR \fIfloat\fR +.RS 4 +Height of range ends\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-gapgroup\fR \fIfloat\fR +.RS 4 +Space between groups\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-postext\fR \fIfloat\fR +.RS 4 +Space between text and ticks, blocks, and ranges\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-graphout\fR \fIgraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +cirdna is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/silent.1e +++ emboss-6.1.0/debian/manpages/silent.1e @@ -0,0 +1,82 @@ +'\" t +.\" Title: SILENT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SILENT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +silent \- Find restriction sites to insert (mutate) with no translation change +.SH "SYNOPSIS" +.HP \w'\fBsilent\fR\ 'u +\fBsilent\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-enzymes\ \fR\fB\fIstring\fR\fR \fB\-sshow\ \fR\fB\fIboolean\fR\fR \fB\-tshow\ \fR\fB\fIboolean\fR\fR \fB\-allmut\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBsilent\fR\ 'u +\fBsilent\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBsilent\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Restriction" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-enzymes\fR \fIstring\fR +.RS 4 +Default value: all +.RE +.SS "Output section" +.PP +\fB\-sshow\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-tshow\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-allmut\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +silent is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/newcpgseek.1e +++ emboss-6.1.0/debian/manpages/newcpgseek.1e @@ -0,0 +1,67 @@ +'\" t +.\" Title: NEWCPGSEEK +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "NEWCPGSEEK" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +newcpgseek \- Identify and report CpG\-rich regions in nucleotide sequence(s) +.SH "SYNOPSIS" +.HP \w'\fBnewcpgseek\fR\ 'u +\fBnewcpgseek\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-score\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBnewcpgseek\fR\ 'u +\fBnewcpgseek\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBnewcpgseek\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:CpG Islands" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-score\fR \fIinteger\fR +.RS 4 +Default value: 17 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +newcpgseek is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/nthseqset.1e +++ emboss-6.1.0/debian/manpages/nthseqset.1e @@ -0,0 +1,71 @@ +'\" t +.\" Title: NTHSEQSET +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "NTHSEQSET" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +nthseqset \- Reads and writes (returns) one set of sequences from many +.SH "SYNOPSIS" +.HP \w'\fBnthseqset\fR\ 'u +\fBnthseqset\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqsetall\fR\fR \fB\-number\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBnthseqset\fR\ 'u +\fBnthseqset\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBnthseqset\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-feature\fR \fIboolean\fR +.RS 4 +.RE +.PP +\fB\-sequence\fR \fIseqsetall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-number\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +nthseqset is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/prophet.1e +++ emboss-6.1.0/debian/manpages/prophet.1e @@ -0,0 +1,76 @@ +'\" t +.\" Title: PROPHET +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PROPHET" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +prophet \- Scan one or more sequences with a Gribskov or Henikoff profile +.SH "SYNOPSIS" +.HP \w'\fBprophet\fR\ 'u +\fBprophet\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-gapopen\ \fR\fB\fIfloat\fR\fR \fB\-gapextend\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIalign\fR\fR +.HP \w'\fBprophet\fR\ 'u +\fBprophet\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBprophet\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Profiles,Protein:Profiles" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-gapopen\fR \fIfloat\fR +.RS 4 +Default value: 1\&.0 +.RE +.PP +\fB\-gapextend\fR \fIfloat\fR +.RS 4 +Default value: 1\&.0 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIalign\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +prophet is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/pscan.1e +++ emboss-6.1.0/debian/manpages/pscan.1e @@ -0,0 +1,72 @@ +'\" t +.\" Title: PSCAN +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PSCAN" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +pscan \- Scans protein sequence(s) with fingerprints from the PRINTS database +.SH "SYNOPSIS" +.HP \w'\fBpscan\fR\ 'u +\fBpscan\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-emin\ \fR\fB\fIinteger\fR\fR \fB\-emax\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBpscan\fR\ 'u +\fBpscan\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBpscan\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Motifs" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-emin\fR \fIinteger\fR +.RS 4 +Default value: 2 +.RE +.PP +\fB\-emax\fR \fIinteger\fR +.RS 4 +Default value: 20 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +pscan is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/demoreport.1e +++ emboss-6.1.0/debian/manpages/demoreport.1e @@ -0,0 +1,61 @@ +'\" t +.\" Title: DEMOREPORT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DEMOREPORT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +demoreport \- Reads a sequence and feature table, writes a report +.SH "SYNOPSIS" +.HP \w'\fBdemoreport\fR\ 'u +\fBdemoreport\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBdemoreport\fR\ 'u +\fBdemoreport\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdemoreport\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +demoreport is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/demostringnew.1e +++ emboss-6.1.0/debian/manpages/demostringnew.1e @@ -0,0 +1,52 @@ +'\" t +.\" Title: DEMOSTRINGNEW +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DEMOSTRINGNEW" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +demostringnew \- Illustrates use of the AJAX string library\&. +.SH "SYNOPSIS" +.HP \w'\fBdemostringnew\fR\ 'u +\fBdemostringnew\fR +.HP \w'\fBdemostringnew\fR\ 'u +\fBdemostringnew\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdemostringnew\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +demostringnew is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/prosextract.1e +++ emboss-6.1.0/debian/manpages/prosextract.1e @@ -0,0 +1,56 @@ +'\" t +.\" Title: PROSEXTRACT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PROSEXTRACT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +prosextract \- Processes the PROSITE motif database for use by patmatmotifs +.SH "SYNOPSIS" +.HP \w'\fBprosextract\fR\ 'u +\fBprosextract\fR \fB\-prositedir\ \fR\fB\fIdirectory\fR\fR +.HP \w'\fBprosextract\fR\ 'u +\fBprosextract\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBprosextract\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database creation" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-prositedir\fR \fIdirectory\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +prosextract is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/seqrettype.1e +++ emboss-6.1.0/debian/manpages/seqrettype.1e @@ -0,0 +1,75 @@ +'\" t +.\" Title: SEQRETTYPE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SEQRETTYPE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +seqrettype \- Reads and writes (returns) sequences +.SH "SYNOPSIS" +.HP \w'\fBseqrettype\fR\ 'u +\fBseqrettype\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-type\ \fR\fB\fIlist\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-firstonly\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBseqrettype\fR\ 'u +\fBseqrettype\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBseqrettype\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-feature\fR \fIboolean\fR +.RS 4 +.RE +.PP +\fB\-type\fR \fIlist\fR +.RS 4 +Default value: any +.RE +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-firstonly\fR \fIboolean\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +seqrettype is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/palindrome.1e +++ emboss-6.1.0/debian/manpages/palindrome.1e @@ -0,0 +1,86 @@ +'\" t +.\" Title: PALINDROME +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PALINDROME" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +palindrome \- Finds inverted repeats in nucleotide sequence(s) +.SH "SYNOPSIS" +.HP \w'\fBpalindrome\fR\ 'u +\fBpalindrome\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-minpallen\ \fR\fB\fIinteger\fR\fR \fB\-maxpallen\ \fR\fB\fIinteger\fR\fR \fB\-gaplimit\ \fR\fB\fIinteger\fR\fR \fB\-nummismatches\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-overlap\ \fR\fB\fIboolean\fR\fR +.HP \w'\fBpalindrome\fR\ 'u +\fBpalindrome\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBpalindrome\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Repeats" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-minpallen\fR \fIinteger\fR +.RS 4 +Default value: 10 +.RE +.PP +\fB\-maxpallen\fR \fIinteger\fR +.RS 4 +Default value: 100 +.RE +.PP +\fB\-gaplimit\fR \fIinteger\fR +.RS 4 +Default value: 100 +.RE +.PP +\fB\-nummismatches\fR \fIinteger\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-overlap\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +palindrome is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/showpep.1e +++ emboss-6.1.0/debian/manpages/showpep.1e @@ -0,0 +1,169 @@ +'\" t +.\" Title: SHOWPEP +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SHOWPEP" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +showpep \- Displays protein sequences with features in pretty format +.SH "SYNOPSIS" +.HP \w'\fBshowpep\fR\ 'u +\fBshowpep\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-format\ \fR\fB\fIlist\fR\fR \fB\-things\ \fR\fB\fIlist\fR\fR [\fB\-uppercase\ \fR\fB\fIrange\fR\fR] [\fB\-highlight\ \fR\fB\fIrange\fR\fR] [\fB\-annotation\ \fR\fB\fIrange\fR\fR] [\fB\-sourcematch\ \fR\fB\fIstring\fR\fR] [\fB\-typematch\ \fR\fB\fIstring\fR\fR] [\fB\-minscore\ \fR\fB\fIfloat\fR\fR] [\fB\-maxscore\ \fR\fB\fIfloat\fR\fR] [\fB\-tagmatch\ \fR\fB\fIstring\fR\fR] [\fB\-valuematch\ \fR\fB\fIstring\fR\fR] [\fB\-stricttags\ \fR\fB\fIboolean\fR\fR] \fB\-threeletter\ \fR\fB\fIboolean\fR\fR \fB\-number\ \fR\fB\fIboolean\fR\fR \fB\-width\ \fR\fB\fIinteger\fR\fR \fB\-length\ \fR\fB\fIinteger\fR\fR \fB\-margin\ \fR\fB\fIinteger\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR \fB\-offset\ \fR\fB\fIinteger\fR\fR \fB\-html\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBshowpep\fR\ 'u +\fBshowpep\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBshowpep\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-format\fR \fIlist\fR +.RS 4 +Default value: 2 +.RE +.PP +\fB\-things\fR \fIlist\fR +.RS 4 +Specify a list of one or more code characters in the order in which you wish things to be displayed one above the other down the page\&. For example if you wish to see things displayed in the order: sequence, ticks line, blank line; then you should enter \'S,T,B\'\&. Default value: B,N,T,S,A,F +.RE +.SS "Additional section" +.PP +\fB\-uppercase\fR \fIrange\fR +.RS 4 +Regions to put in uppercase\&. If this is left blank, then the sequence case is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are separated by any non\-digit, non\-alpha character\&. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765\&.\&.888 1,5,8,10,23,45,57,99 +.RE +.PP +\fB\-highlight\fR \fIrange\fR +.RS 4 +Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \'@filename\'\&. +.RE +.PP +\fB\-annotation\fR \fIrange\fR +.RS 4 +Regions to annotate by marking\&. If this is left blank, then no annotation is added\&. A set of regions is specified by a set of pairs of positions followed by optional text\&. The positions are integers\&. They are followed by any text (but not digits when on the command\-line)\&. Examples of region specifications are: 24\-45 new domain 56\-78 match to Mouse 1\-100 First part 120\-156 oligo A file of ranges to annotate (one range per line) can be specified as \'@filename\'\&. +.RE +.SS "Feature display options" +.PP +\fB\-sourcematch\fR \fIstring\fR +.RS 4 +By default any feature source in the feature table is shown\&. You can set this to match any feature source you wish to show\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \'*\'\&. If you wish to show more than one source, separate their names with the character \'|\', eg: gene* | embl Default value: * +.RE +.PP +\fB\-typematch\fR \fIstring\fR +.RS 4 +By default any feature type in the feature table is shown\&. You can set this to match any feature type you wish to show\&. See http://www3\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.ch/txt/userman\&.txt for a list of the Swissprot feature types\&. The type may be wildcarded by using \'*\'\&. If you wish to show more than one type, separate their names with the character \'|\', eg: *UTR | intron Default value: * +.RE +.PP +\fB\-minscore\fR \fIfloat\fR +.RS 4 +Minimum score of feature to display (see also maxscore) Default value: 0\&.0 +.RE +.PP +\fB\-maxscore\fR \fIfloat\fR +.RS 4 +Maximum score of feature to display\&. If both minscore and maxscore are zero (the default), then any score is ignored Default value: 0\&.0 +.RE +.PP +\fB\-tagmatch\fR \fIstring\fR +.RS 4 +Tags are the types of extra values that a feature may have\&. By default any feature tag in the feature table is shown\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \'*\'\&. If you wish to show more than one tag, separate their names with the character \'|\', eg: gene | label Default value: * +.RE +.PP +\fB\-valuematch\fR \fIstring\fR +.RS 4 +Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. By default any feature tag value in the feature table is shown\&. You can set this to match any feature tag valueyou wish to show\&. The tag value may be wildcarded by using \'*\'\&. If you wish to show more than one tag value, separate their names with the character \'|\', eg: pax* | 10 Default value: * +.RE +.PP +\fB\-stricttags\fR \fIboolean\fR +.RS 4 +By default if any tag/value pair in a feature matches the specified tag and value, then all the tags/value pairs of that feature will be displayed\&. If this is set to be true, then only those tag/value pairs in a feature that match the specified tag and value will be displayed\&. Default value: N +.RE +.SS "Advanced section" +.PP +\fB\-threeletter\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-number\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-width\fR \fIinteger\fR +.RS 4 +Default value: 60 +.RE +.PP +\fB\-length\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-margin\fR \fIinteger\fR +.RS 4 +Default value: 10 +.RE +.PP +\fB\-name\fR \fIboolean\fR +.RS 4 +Set this to be false if you do not wish to display the ID name of the sequence Default value: Y +.RE +.PP +\fB\-description\fR \fIboolean\fR +.RS 4 +Set this to be false if you do not wish to display the description of the sequence Default value: Y +.RE +.PP +\fB\-offset\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-html\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +showpep is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/dotpath.1e +++ emboss-6.1.0/debian/manpages/dotpath.1e @@ -0,0 +1,81 @@ +'\" t +.\" Title: DOTPATH +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DOTPATH" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +dotpath \- Draw a non\-overlapping wordmatch dotplot of two sequences +.SH "SYNOPSIS" +.HP \w'\fBdotpath\fR\ 'u +\fBdotpath\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR [\fB\-overlaps\ \fR\fB\fIboolean\fR\fR] [\fB\-boxit\ \fR\fB\fIboolean\fR\fR] \fB\-graph\ \fR\fB\fIgraph\fR\fR +.HP \w'\fBdotpath\fR\ 'u +\fBdotpath\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdotpath\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Dot plots" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-asequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-bsequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-wordsize\fR \fIinteger\fR +.RS 4 +Default value: 4 +.RE +.SS "Output section" +.PP +\fB\-overlaps\fR \fIboolean\fR +.RS 4 +Displays the overlapping matches (in red) as well as the minimal set of non\-overlapping matches Default value: N +.RE +.PP +\fB\-boxit\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-graph\fR \fIgraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +dotpath is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/patmattest.1e +++ emboss-6.1.0/debian/manpages/patmattest.1e @@ -0,0 +1,66 @@ +'\" t +.\" Title: PATMATTEST +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PATMATTEST" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +patmattest \- Test of pattern matching +.SH "SYNOPSIS" +.HP \w'\fBpatmattest\fR\ 'u +\fBpatmattest\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-expression\ \fR\fB\fIstring\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBpatmattest\fR\ 'u +\fBpatmattest\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBpatmattest\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Test" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-expression\fR \fIstring\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +Default value: stdout +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +patmattest is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/acdtrace.1e +++ emboss-6.1.0/debian/manpages/acdtrace.1e @@ -0,0 +1,56 @@ +'\" t +.\" Title: ACDTRACE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ACDTRACE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +acdtrace \- Trace processing of an application ACD file (for testing) +.SH "SYNOPSIS" +.HP \w'\fBacdtrace\fR\ 'u +\fBacdtrace\fR \fB\-program\ \fR\fB\fIstring\fR\fR +.HP \w'\fBacdtrace\fR\ 'u +\fBacdtrace\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBacdtrace\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd" command group(s)\&. +.SH "OPTIONS" +.SS "Required section" +.PP +\fB\-program\fR \fIstring\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +acdtrace is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/restrict.1e +++ emboss-6.1.0/debian/manpages/restrict.1e @@ -0,0 +1,152 @@ +'\" t +.\" Title: RESTRICT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "RESTRICT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +restrict \- Report restriction enzyme cleavage sites in a nucleotide sequence +.SH "SYNOPSIS" +.HP \w'\fBrestrict\fR\ 'u +\fBrestrict\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-datafile\ \fR\fB\fIdatafile\fR\fR \fB\-mfile\ \fR\fB\fIdatafile\fR\fR \fB\-sitelen\ \fR\fB\fIinteger\fR\fR \fB\-enzymes\ \fR\fB\fIstring\fR\fR \fB\-min\ \fR\fB\fIinteger\fR\fR \fB\-max\ \fR\fB\fIinteger\fR\fR \fB\-solofragment\ \fR\fB\fIboolean\fR\fR \fB\-single\ \fR\fB\fIboolean\fR\fR \fB\-blunt\ \fR\fB\fIboolean\fR\fR \fB\-sticky\ \fR\fB\fIboolean\fR\fR \fB\-ambiguity\ \fR\fB\fIboolean\fR\fR \fB\-plasmid\ \fR\fB\fIboolean\fR\fR \fB\-methylation\ \fR\fB\fIboolean\fR\fR \fB\-commercial\ \fR\fB\fIboolean\fR\fR \fB\-limit\ \fR\fB\fIboolean\fR\fR \fB\-alphabetic\ \fR\fB\fIboolean\fR\fR \fB\-fragments\ \fR\fB\fIboolean\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBrestrict\fR\ 'u +\fBrestrict\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBrestrict\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Restriction" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fIdatafile\fR +.RS 4 +.RE +.PP +\fB\-mfile\fR \fIdatafile\fR +.RS 4 +Default value: Emethylsites\&.dat +.RE +.SS "Required section" +.PP +\fB\-sitelen\fR \fIinteger\fR +.RS 4 +This sets the minimum length of the restriction enzyme recognition site\&. Any enzymes with sites shorter than this will be ignored\&. Default value: 4 +.RE +.PP +\fB\-enzymes\fR \fIstring\fR +.RS 4 +The name \'all\' reads in all enzyme names from the REBASE database\&. You can specify enzymes by giving their names with commas between then, such as: \'HincII,hinfI,ppiI,hindiii\'\&. The case of the names is not important\&. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a \'@\' character in front of it, for example, \'@enz\&.list\'\&. Blank lines and lines starting with a hash character or \'!\' are ignored and all other lines are concatenated together with a comma character \',\' and then treated as the list of enzymes to search for\&. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Default value: all +.RE +.SS "Advanced section" +.PP +\fB\-min\fR \fIinteger\fR +.RS 4 +This sets the minimum number of cuts for any restriction enzyme that will be considered\&. Any enzymes that cut fewer times than this will be ignored\&. Default value: 1 +.RE +.PP +\fB\-max\fR \fIinteger\fR +.RS 4 +This sets the maximum number of cuts for any restriction enzyme that will be considered\&. Any enzymes that cut more times than this will be ignored\&. Default value: 2000000000 +.RE +.PP +\fB\-solofragment\fR \fIboolean\fR +.RS 4 +This gives the fragment lengths of the forward sense strand produced by complete restriction by each restriction enzyme on its own\&. Results are added to the tail section of the report\&. Default value: N +.RE +.PP +\fB\-single\fR \fIboolean\fR +.RS 4 +If this is set then this forces the values of the mincuts and maxcuts qualifiers to both be 1\&. Any other value you may have set them to will be ignored\&. Default value: N +.RE +.PP +\fB\-blunt\fR \fIboolean\fR +.RS 4 +This allows those enzymes which cut at the same position on the forward and reverse strands to be considered\&. Default value: Y +.RE +.PP +\fB\-sticky\fR \fIboolean\fR +.RS 4 +This allows those enzymes which cut at different positions on the forward and reverse strands, leaving an overhang, to be considered\&. Default value: Y +.RE +.PP +\fB\-ambiguity\fR \fIboolean\fR +.RS 4 +This allows those enzymes which have one or more \'N\' ambiguity codes in their pattern to be considered Default value: Y +.RE +.PP +\fB\-plasmid\fR \fIboolean\fR +.RS 4 +If this is set then this allows searches for restriction enzyme recognition site and cut postions that span the end of the sequence to be considered\&. Default value: N +.RE +.PP +\fB\-methylation\fR \fIboolean\fR +.RS 4 +If this is set then RE recognition sites will not match methylated bases\&. Default value: N +.RE +.PP +\fB\-commercial\fR \fIboolean\fR +.RS 4 +If this is set, then only those enzymes with a commercial supplier will be searched for\&. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through \'all\' the enzymes in the REBASE database\&. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier\&. Default value: Y +.RE +.SS "Output section" +.PP +\fB\-limit\fR \fIboolean\fR +.RS 4 +This limits the reporting of enzymes to just one enzyme from each group of isoschizomers\&. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file \'embossre\&.equ\', which is created by the program \'rebaseextract\'\&. If you prefer different prototypes to be used, make a copy of embossre\&.equ in your home directory and edit it\&. If this value is set to be false then all of the input enzymes will be reported\&. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching \'all\' of them\&. Default value: Y +.RE +.PP +\fB\-alphabetic\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-fragments\fR \fIboolean\fR +.RS 4 +This gives the fragment lengths of the forward sense strand produced by complete restriction using all of the input enzymes together\&. Results are added to the tail section of the report\&. Default value: N +.RE +.PP +\fB\-name\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +restrict is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/extractfeat.1e +++ emboss-6.1.0/debian/manpages/extractfeat.1e @@ -0,0 +1,122 @@ +'\" t +.\" Title: EXTRACTFEAT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "EXTRACTFEAT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +extractfeat \- Extract features from sequence(s) +.SH "SYNOPSIS" +.HP \w'\fBextractfeat\fR\ 'u +\fBextractfeat\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-before\ \fR\fB\fIinteger\fR\fR] [\fB\-after\ \fR\fB\fIinteger\fR\fR] [\fB\-source\ \fR\fB\fIstring\fR\fR] [\fB\-type\ \fR\fB\fIstring\fR\fR] [\fB\-sense\ \fR\fB\fIinteger\fR\fR] [\fB\-minscore\ \fR\fB\fIfloat\fR\fR] [\fB\-maxscore\ \fR\fB\fIfloat\fR\fR] [\fB\-tag\ \fR\fB\fIstring\fR\fR] [\fB\-value\ \fR\fB\fIstring\fR\fR] [\fB\-join\ \fR\fB\fIboolean\fR\fR] [\fB\-featinname\ \fR\fB\fIboolean\fR\fR] [\fB\-describe\ \fR\fB\fIstring\fR\fR] \fB\-outseq\ \fR\fB\fIseqout\fR\fR +.HP \w'\fBextractfeat\fR\ 'u +\fBextractfeat\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBextractfeat\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit,Feature tables" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-before\fR \fIinteger\fR +.RS 4 +If this value is greater than 0 then that number of bases or residues before the feature are included in the extracted sequence\&. This allows you to get the context of the feature\&. If this value is negative then the start of the extracted sequence will be this number of bases/residues before the end of the feature\&. So a value of \'10\' will start the extraction 10 bases/residues before the start of the sequence, and a value of \'\-10\' will start the extraction 10 bases/residues before the end of the feature\&. The output sequence will be padded with \'N\' or \'X\' characters if the sequence starts after the required start of the extraction\&. +.RE +.PP +\fB\-after\fR \fIinteger\fR +.RS 4 +If this value is greater than 0 then that number of bases or residues after the feature are included in the extracted sequence\&. This allows you to get the context of the feature\&. If this value is negative then the end of the extracted sequence will be this number of bases/residues after the start of the feature\&. So a value of \'10\' will end the extraction 10 bases/residues after the end of the sequence, and a value of \'\-10\' will end the extraction 10 bases/residues after the start of the feature\&. The output sequence will be padded with \'N\' or \'X\' characters if the sequence ends before the required end of the extraction\&. +.RE +.PP +\fB\-source\fR \fIstring\fR +.RS 4 +By default any feature source in the feature table is shown\&. You can set this to match any feature source you wish to show\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \'*\'\&. If you wish to show more than one source, separate their names with the character \'|\', eg: gene* | embl Default value: * +.RE +.PP +\fB\-type\fR \fIstring\fR +.RS 4 +By default every feature in the feature table is extracted\&. You can set this to be any feature type you wish to extract\&. See http://www\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see the Uniprot user manual in http://www\&.uniprot\&.org/manual/sequence_annotation for a list of the Uniprot feature types\&. The type may be wildcarded by using \'*\'\&. If you wish to extract more than one type, separate their names with the character \'|\', eg: *UTR | intron Default value: * +.RE +.PP +\fB\-sense\fR \fIinteger\fR +.RS 4 +By default any feature type in the feature table is extracted\&. You can set this to match any feature sense you wish\&. 0 \- any sense, 1 \- forward sense, \-1 \- reverse sense +.RE +.PP +\fB\-minscore\fR \fIfloat\fR +.RS 4 +Minimum score of feature to extract (see also maxscore) Default value: 0\&.0 +.RE +.PP +\fB\-maxscore\fR \fIfloat\fR +.RS 4 +Maximum score of feature to extract\&. If both minscore and maxscore are zero (the default), then any score is ignored Default value: 0\&.0 +.RE +.PP +\fB\-tag\fR \fIstring\fR +.RS 4 +Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Some of these tags also have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag in the feature table is extracted\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \'*\'\&. If you wish to extract more than one tag, separate their names with the character \'|\', eg: gene | label Default value: * +.RE +.PP +\fB\-value\fR \fIstring\fR +.RS 4 +Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Only some of these tags can have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag value in the feature table is shown\&. You can set this to match any feature tag valueyou wish to show\&. The tag value may be wildcarded by using \'*\'\&. If you wish to show more than one tag value, separate their names with a space or the character \'|\', eg: pax* | 10 Default value: * +.RE +.SS "Output section" +.PP +\fB\-join\fR \fIboolean\fR +.RS 4 +Some features, such as CDS (coding sequence) and mRNA are composed of introns concatenated together\&. There may be other forms of \'joined\' sequence, depending on the feature table\&. If this option is set TRUE, then any group of these features will be output as a single sequence\&. If the \'before\' and \'after\' qualifiers have been set, then only the sequence before the first feature and after the last feature are added\&. Default value: N +.RE +.PP +\fB\-featinname\fR \fIboolean\fR +.RS 4 +To aid you in identifying the type of feature that has been output, the type of feature is added to the start of the description of the output sequence\&. Sometimes the description of a sequence is lost in subsequent processing of the sequences file, so it is useful for the type to be a part of the sequence ID name\&. If you set this to be TRUE then the name is added to the ID name of the output sequence\&. Default value: N +.RE +.PP +\fB\-describe\fR \fIstring\fR +.RS 4 +To aid you in identifying some further properties of a feature that has been output, this lets you specify one or more tag names that should be added to the output sequence Description text, together with their values (if any)\&. For example, if this is set to be \'gene\', then if any output feature has the tag (for example) \'/gene=BRCA1\' associated with it, then the text \'(gene=BRCA1)\' will be added to the Description line\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Some of these tags also have values, for example \'/gene\' can have the value of the gene name\&. By default no feature tag is displayed\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \'*\'\&. If you wish to extract more than one tag, separate their names with the character \'|\', eg: gene | label +.RE +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +extractfeat is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/dan.1e +++ emboss-6.1.0/debian/manpages/dan.1e @@ -0,0 +1,136 @@ +'\" t +.\" Title: DAN +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DAN" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +dan \- Calculates nucleic acid melting temperature +.SH "SYNOPSIS" +.HP \w'\fBdan\fR\ 'u +\fBdan\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-windowsize\ \fR\fB\fIinteger\fR\fR \fB\-shiftincrement\ \fR\fB\fIinteger\fR\fR \fB\-dnaconc\ \fR\fB\fIfloat\fR\fR \fB\-saltconc\ \fR\fB\fIfloat\fR\fR [\fB\-product\ \fR\fB\fItoggle\fR\fR] \fB\-formamide\ \fR\fB\fIfloat\fR\fR \fB\-mismatch\ \fR\fB\fIfloat\fR\fR \fB\-prodlen\ \fR\fB\fIinteger\fR\fR [\fB\-thermo\ \fR\fB\fItoggle\fR\fR] \fB\-temperature\ \fR\fB\fIfloat\fR\fR \fB\-rna\ \fR\fB\fIboolean\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-mintemp\ \fR\fB\fIfloat\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBdan\fR\ 'u +\fBdan\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdan\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-windowsize\fR \fIinteger\fR +.RS 4 +The values of melting point and other thermodynamic properties of the sequence are determined by taking a short length of sequence known as a window and determining the properties of the sequence in that window\&. The window is incrementally moved along the sequence with the properties being calculated at each new position\&. Default value: 20 +.RE +.PP +\fB\-shiftincrement\fR \fIinteger\fR +.RS 4 +This is the amount by which the window is moved at each increment in order to find the melting point and other properties along the sequence\&. Default value: 1 +.RE +.PP +\fB\-dnaconc\fR \fIfloat\fR +.RS 4 +Default value: 50\&. +.RE +.PP +\fB\-saltconc\fR \fIfloat\fR +.RS 4 +Default value: 50\&. +.RE +.SS "Additional section" +.SS "Product options" +.PP +\fB\-product\fR \fItoggle\fR +.RS 4 +This prompts for percent formamide, percent of mismatches allowed and product length\&. +.RE +.PP +\fB\-formamide\fR \fIfloat\fR +.RS 4 +This specifies the percent formamide to be used in calculations (it is ignored unless \-product is used)\&. Default value: 0\&. +.RE +.PP +\fB\-mismatch\fR \fIfloat\fR +.RS 4 +This specifies the percent mismatch to be used in calculations (it is ignored unless \-product is used)\&. Default value: 0\&. +.RE +.PP +\fB\-prodlen\fR \fIinteger\fR +.RS 4 +This specifies the product length to be used in calculations (it is ignored unless \-product is used)\&. Default value: $(windowSize) +.RE +.SS "Thermodynamic options" +.PP +\fB\-thermo\fR \fItoggle\fR +.RS 4 +Output the DeltaG, DeltaH and DeltaS values of the sequence windows to the output data file\&. +.RE +.PP +\fB\-temperature\fR \fIfloat\fR +.RS 4 +If \-thermo has been specified then this specifies the temperature at which to calculate the DeltaG, DeltaH and DeltaS values\&. Default value: 25\&. +.RE +.SS "Advanced section" +.PP +\fB\-rna\fR \fIboolean\fR +.RS 4 +This specifies that the sequence is an RNA sequence and not a DNA sequence\&. +.RE +.SS "Output section" +.PP +\fB\-plot\fR \fItoggle\fR +.RS 4 +If this is not specified then the file of output data is produced, else a plot of the melting point along the sequence is produced\&. +.RE +.PP +\fB\-mintemp\fR \fIfloat\fR +.RS 4 +Enter a minimum value for the temperature scale (y\-axis) of the plot\&. Default value: 55\&. +.RE +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +If a plot is not being produced then data on the melting point etc\&. in each window along the sequence is output to the file\&. +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +dan is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/dbxreport.1e +++ emboss-6.1.0/debian/manpages/dbxreport.1e @@ -0,0 +1,78 @@ +'\" t +.\" Title: DBXREPORT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DBXREPORT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +dbxreport \- Validate index and report internals for dbx databases +.SH "SYNOPSIS" +.HP \w'\fBdbxreport\fR\ 'u +\fBdbxreport\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-indexdir\ \fR\fB\fIdirectory\fR\fR \fB\-idtype\ \fR\fB\fIlist\fR\fR \fB\-fullreport\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBdbxreport\fR\ 'u +\fBdbxreport\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdbxreport\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database indexing" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-dbname\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-indexdir\fR \fIdirectory\fR +.RS 4 +Default value: \&. +.RE +.PP +\fB\-idtype\fR \fIlist\fR +.RS 4 +Default value: all +.RE +.SS "Required section" +.SS "Advanced section" +.PP +\fB\-fullreport\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +dbxreport is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/prettyplot.1e +++ emboss-6.1.0/debian/manpages/prettyplot.1e @@ -0,0 +1,182 @@ +'\" t +.\" Title: PRETTYPLOT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PRETTYPLOT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +prettyplot \- Draw a sequence alignment with pretty formatting +.SH "SYNOPSIS" +.HP \w'\fBprettyplot\fR\ 'u +\fBprettyplot\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR [\fB\-matrixfile\ \fR\fB\fImatrix\fR\fR] [\fB\-residuesperline\ \fR\fB\fIinteger\fR\fR] [\fB\-resbreak\ \fR\fB\fIinteger\fR\fR] [\fB\-ccolours\ \fR\fB\fIboolean\fR\fR] [\fB\-cidentity\ \fR\fB\fIstring\fR\fR] [\fB\-csimilarity\ \fR\fB\fIstring\fR\fR] [\fB\-cother\ \fR\fB\fIstring\fR\fR] [\fB\-docolour\ \fR\fB\fIboolean\fR\fR] [\fB\-shade\ \fR\fB\fIstring\fR\fR] [\fB\-pair\ \fR\fB\fIarray\fR\fR] [\fB\-identity\ \fR\fB\fIinteger\fR\fR] [\fB\-box\ \fR\fB\fIboolean\fR\fR] [\fB\-boxcol\ \fR\fB\fIboolean\fR\fR] [\fB\-boxuse\ \fR\fB\fIstring\fR\fR] [\fB\-name\ \fR\fB\fIboolean\fR\fR] [\fB\-maxnamelen\ \fR\fB\fIinteger\fR\fR] [\fB\-number\ \fR\fB\fIboolean\fR\fR] [\fB\-listoptions\ \fR\fB\fIboolean\fR\fR] [\fB\-plurality\ \fR\fB\fIfloat\fR\fR] [\fB\-consensus\ \fR\fB\fIboolean\fR\fR] [\fB\-collision\ \fR\fB\fIboolean\fR\fR] [\fB\-alternative\ \fR\fB\fIlist\fR\fR] [\fB\-showscore\ \fR\fB\fIinteger\fR\fR] [\fB\-portrait\ \fR\fB\fIboolean\fR\fR] \fB\-graph\ \fR\fB\fIgraph\fR\fR +.HP \w'\fBprettyplot\fR\ 'u +\fBprettyplot\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBprettyplot\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Multiple,Display" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequences\fR \fIseqset\fR +.RS 4 +.RE +.PP +\fB\-matrixfile\fR \fImatrix\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.SS "Additional section" +.PP +\fB\-residuesperline\fR \fIinteger\fR +.RS 4 +The number of residues to be displayed on each line Default value: 50 +.RE +.PP +\fB\-resbreak\fR \fIinteger\fR +.RS 4 +Default value: $(residuesperline) +.RE +.PP +\fB\-ccolours\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-cidentity\fR \fIstring\fR +.RS 4 +Default value: RED +.RE +.PP +\fB\-csimilarity\fR \fIstring\fR +.RS 4 +Default value: GREEN +.RE +.PP +\fB\-cother\fR \fIstring\fR +.RS 4 +Default value: BLACK +.RE +.PP +\fB\-docolour\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-shade\fR \fIstring\fR +.RS 4 +Set to BPLW for normal shading (black, pale, light, white) so for pair = 1\&.5,1\&.0,0\&.5 and shade = BPLW Residues score Colour 1\&.5 or over\&.\&.\&. BLACK (B) 1\&.0 to 1\&.5 \&.\&.\&. BROWN (P) 0\&.5 to 1\&.0 \&.\&.\&. WHEAT (L) under 0\&.5 \&.\&.\&.\&. WHITE (W) The only four letters allowed are BPLW, in any order\&. +.RE +.PP +\fB\-pair\fR \fIarray\fR +.RS 4 +Default value: 1\&.5,1\&.0,0\&.5 +.RE +.PP +\fB\-identity\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-box\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-boxcol\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-boxuse\fR \fIstring\fR +.RS 4 +Default value: GREY +.RE +.PP +\fB\-name\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-maxnamelen\fR \fIinteger\fR +.RS 4 +Default value: 10 +.RE +.PP +\fB\-number\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-listoptions\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-plurality\fR \fIfloat\fR +.RS 4 +Default value: @( $(sequences\&.totweight) / 2) +.RE +.SS "Consensus section" +.PP +\fB\-consensus\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-collision\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-alternative\fR \fIlist\fR +.RS 4 +Values are 0:Normal collision check\&. (default) 1:Compares identical scores with the max score found\&. So if any other residue matches the identical score then a collision has occurred\&. 2:If another residue has a greater than or equal to matching score and these do not match then a collision has occurred\&. 3:Checks all those not in the current consensus\&.If any of these give a top score for matching or identical scores then a collision has occured\&. +.RE +.PP +\fB\-showscore\fR \fIinteger\fR +.RS 4 +Default value: \-1 +.RE +.PP +\fB\-portrait\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-graph\fR \fIgraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +prettyplot is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/seqret.1e +++ emboss-6.1.0/debian/manpages/seqret.1e @@ -0,0 +1,71 @@ +'\" t +.\" Title: SEQRET +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SEQRET" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +seqret \- Reads and writes (returns) sequences +.SH "SYNOPSIS" +.HP \w'\fBseqret\fR\ 'u +\fBseqret\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-firstonly\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBseqret\fR\ 'u +\fBseqret\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBseqret\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-feature\fR \fIboolean\fR +.RS 4 +.RE +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-firstonly\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +seqret is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/seqmatchall.1e +++ emboss-6.1.0/debian/manpages/seqmatchall.1e @@ -0,0 +1,67 @@ +'\" t +.\" Title: SEQMATCHALL +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SEQMATCHALL" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +seqmatchall \- All\-against\-all word comparison of a sequence set +.SH "SYNOPSIS" +.HP \w'\fBseqmatchall\fR\ 'u +\fBseqmatchall\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIalign\fR\fR +.HP \w'\fBseqmatchall\fR\ 'u +\fBseqmatchall\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBseqmatchall\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Local" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqset\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-wordsize\fR \fIinteger\fR +.RS 4 +Default value: 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIalign\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +seqmatchall is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/water.1e +++ emboss-6.1.0/debian/manpages/water.1e @@ -0,0 +1,86 @@ +'\" t +.\" Title: WATER +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "WATER" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +water \- Smith\-Waterman local alignment of sequences +.SH "SYNOPSIS" +.HP \w'\fBwater\fR\ 'u +\fBwater\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIseqall\fR\fR [\fB\-datafile\ \fR\fB\fImatrixf\fR\fR] \fB\-gapopen\ \fR\fB\fIfloat\fR\fR \fB\-gapextend\ \fR\fB\fIfloat\fR\fR \fB\-brief\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIalign\fR\fR +.HP \w'\fBwater\fR\ 'u +\fBwater\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBwater\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Local" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-asequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-bsequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fImatrixf\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.SS "Required section" +.PP +\fB\-gapopen\fR \fIfloat\fR +.RS 4 +The gap open penalty is the score taken away when a gap is created\&. The best value depends on the choice of comparison matrix\&. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences\&. Default value: @($(acdprotein)? 10\&.0 : 10\&.0) +.RE +.PP +\fB\-gapextend\fR \fIfloat\fR +.RS 4 +The gap extension penalty is added to the standard gap penalty for each base or residue in the gap\&. This is how long gaps are penalized\&. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty\&. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps\&. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring\&. Default value: @($(acdprotein)? 0\&.5 : 0\&.5) +.RE +.SS "Output section" +.PP +\fB\-brief\fR \fIboolean\fR +.RS 4 +Brief identity and similarity Default value: Y +.RE +.PP +\fB\-outfile\fR \fIalign\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +water is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/dbxflat.1e +++ emboss-6.1.0/debian/manpages/dbxflat.1e @@ -0,0 +1,106 @@ +'\" t +.\" Title: DBXFLAT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DBXFLAT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +dbxflat \- Index a flat file database using b+tree indices +.SH "SYNOPSIS" +.HP \w'\fBdbxflat\fR\ 'u +\fBdbxflat\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBdbxflat\fR\ 'u +\fBdbxflat\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdbxflat\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database indexing" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-dbname\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-dbresource\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-idformat\fR \fIlist\fR +.RS 4 +Default value: SWISS +.RE +.PP +\fB\-filenames\fR \fIstring\fR +.RS 4 +Default value: *\&.dat +.RE +.PP +\fB\-directory\fR \fIdirectory\fR +.RS 4 +Default value: \&. +.RE +.SS "Required section" +.PP +\fB\-fields\fR \fIlist\fR +.RS 4 +Default value: id,acc +.RE +.SS "Advanced section" +.PP +\fB\-release\fR \fIstring\fR +.RS 4 +Default value: 0\&.0 +.RE +.PP +\fB\-date\fR \fIstring\fR +.RS 4 +Default value: 00/00/00 +.RE +.PP +\fB\-exclude\fR \fIstring\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-indexoutdir\fR \fIoutdir\fR +.RS 4 +Default value: \&. +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +dbxflat is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/dottup.1e +++ emboss-6.1.0/debian/manpages/dottup.1e @@ -0,0 +1,85 @@ +'\" t +.\" Title: DOTTUP +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DOTTUP" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +dottup \- Displays a wordmatch dotplot of two sequences +.SH "SYNOPSIS" +.HP \w'\fBdottup\fR\ 'u +\fBdottup\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR \fB\-stretch\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIgraph\fR\fR \fB\-xygraph\ \fR\fB\fIxygraph\fR\fR \fB\-boxit\ \fR\fB\fIboolean\fR\fR +.HP \w'\fBdottup\fR\ 'u +\fBdottup\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdottup\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Dot plots" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-asequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-bsequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-wordsize\fR \fIinteger\fR +.RS 4 +Default value: 10 +.RE +.SS "Output section" +.PP +\fB\-stretch\fR \fItoggle\fR +.RS 4 +Use non\-proportional axes Default value: N +.RE +.PP +\fB\-graph\fR \fIgraph\fR +.RS 4 +.RE +.PP +\fB\-xygraph\fR \fIxygraph\fR +.RS 4 +.RE +.PP +\fB\-boxit\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +dottup is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/seqretsplit.1e +++ emboss-6.1.0/debian/manpages/seqretsplit.1e @@ -0,0 +1,70 @@ +'\" t +.\" Title: SEQRETSPLIT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SEQRETSPLIT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +seqretsplit \- Reads sequences and writes them to individual files +.SH "SYNOPSIS" +.HP \w'\fBseqretsplit\fR\ 'u +\fBseqretsplit\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-firstonly\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBseqretsplit\fR\ 'u +\fBseqretsplit\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBseqretsplit\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-feature\fR \fIboolean\fR +.RS 4 +.RE +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-firstonly\fR \fIboolean\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +seqretsplit is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/noreturn.1e +++ emboss-6.1.0/debian/manpages/noreturn.1e @@ -0,0 +1,67 @@ +'\" t +.\" Title: NORETURN +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "NORETURN" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +noreturn \- Remove carriage return from ASCII files +.SH "SYNOPSIS" +.HP \w'\fBnoreturn\fR\ 'u +\fBnoreturn\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-system\ \fR\fB\fIlist\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBnoreturn\fR\ 'u +\fBnoreturn\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBnoreturn\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-system\fR \fIlist\fR +.RS 4 +Default value: unix +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +noreturn is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/restover.1e +++ emboss-6.1.0/debian/manpages/restover.1e @@ -0,0 +1,146 @@ +'\" t +.\" Title: RESTOVER +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "RESTOVER" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +restover \- Find restriction enzymes producing a specific overhang +.SH "SYNOPSIS" +.HP \w'\fBrestover\fR\ 'u +\fBrestover\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-datafile\ \fR\fB\fIdatafile\fR\fR \fB\-mfile\ \fR\fB\fIdatafile\fR\fR \fB\-seqcomp\ \fR\fB\fIstring\fR\fR \fB\-min\ \fR\fB\fIinteger\fR\fR \fB\-max\ \fR\fB\fIinteger\fR\fR \fB\-single\ \fR\fB\fIboolean\fR\fR \fB\-threeprime\ \fR\fB\fIboolean\fR\fR \fB\-blunt\ \fR\fB\fIboolean\fR\fR \fB\-sticky\ \fR\fB\fIboolean\fR\fR \fB\-ambiguity\ \fR\fB\fIboolean\fR\fR \fB\-plasmid\ \fR\fB\fIboolean\fR\fR \fB\-methylation\ \fR\fB\fIboolean\fR\fR \fB\-commercial\ \fR\fB\fIboolean\fR\fR \fB\-html\ \fR\fB\fIboolean\fR\fR \fB\-limit\ \fR\fB\fIboolean\fR\fR \fB\-alphabetic\ \fR\fB\fIboolean\fR\fR \fB\-fragments\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBrestover\fR\ 'u +\fBrestover\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBrestover\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Restriction" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fIdatafile\fR +.RS 4 +.RE +.PP +\fB\-mfile\fR \fIdatafile\fR +.RS 4 +Default value: Emethylsites\&.dat +.RE +.SS "Required section" +.PP +\fB\-seqcomp\fR \fIstring\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-min\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-max\fR \fIinteger\fR +.RS 4 +Default value: 2000000000 +.RE +.PP +\fB\-single\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-threeprime\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-blunt\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-sticky\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-ambiguity\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-plasmid\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-methylation\fR \fIboolean\fR +.RS 4 +If this is set then RE recognition sites will not match methylated bases\&. Default value: N +.RE +.PP +\fB\-commercial\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.SS "Output section" +.PP +\fB\-html\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-limit\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-alphabetic\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-fragments\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +restover is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/checktrans.1e +++ emboss-6.1.0/debian/manpages/checktrans.1e @@ -0,0 +1,83 @@ +'\" t +.\" Title: CHECKTRANS +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CHECKTRANS" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +checktrans \- Reports STOP codons and ORF statistics of a protein +.SH "SYNOPSIS" +.HP \w'\fBchecktrans\fR\ 'u +\fBchecktrans\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-orfml\ \fR\fB\fIinteger\fR\fR [\fB\-addlast\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR +.HP \w'\fBchecktrans\fR\ 'u +\fBchecktrans\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBchecktrans\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-orfml\fR \fIinteger\fR +.RS 4 +Default value: 100 +.RE +.SS "Additional section" +.PP +\fB\-addlast\fR \fIboolean\fR +.RS 4 +An asterisk in the protein sequence indicates the position of a STOP codon\&. Checktrans assumes that all ORFs end in a STOP codon\&. Forcing the sequence to end with an asterisk, if there is not one there already, makes checktrans treat the end as a potential ORF\&. If an asterisk is added, it is not included in the reported count of STOPs\&. Default value: Y +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +Sequence file to hold output ORF sequences +.RE +.PP +\fB\-outfeat\fR \fIfeatout\fR +.RS 4 +File for output features +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +checktrans is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/vectorstrip.1e +++ emboss-6.1.0/debian/manpages/vectorstrip.1e @@ -0,0 +1,99 @@ +'\" t +.\" Title: VECTORSTRIP +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "VECTORSTRIP" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +vectorstrip \- Removes vectors from the ends of nucleotide sequence(s) +.SH "SYNOPSIS" +.HP \w'\fBvectorstrip\fR\ 'u +\fBvectorstrip\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-readfile\ \fR\fB\fItoggle\fR\fR \fB\-vectorsfile\ \fR\fB\fIinfile\fR\fR \fB\-mismatch\ \fR\fB\fIinteger\fR\fR \fB\-besthits\ \fR\fB\fIboolean\fR\fR \fB\-alinker\ \fR\fB\fIstring\fR\fR \fB\-blinker\ \fR\fB\fIstring\fR\fR [\fB\-allsequences\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBvectorstrip\fR\ 'u +\fBvectorstrip\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBvectorstrip\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Vector input options" +.PP +\fB\-readfile\fR \fItoggle\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-vectorsfile\fR \fIinfile\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-mismatch\fR \fIinteger\fR +.RS 4 +Default value: 10 +.RE +.PP +\fB\-besthits\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-alinker\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-blinker\fR \fIstring\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-allsequences\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +vectorstrip is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/dbxstat.1e +++ emboss-6.1.0/debian/manpages/dbxstat.1e @@ -0,0 +1,82 @@ +'\" t +.\" Title: DBXSTAT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DBXSTAT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +dbxstat \- Dump statistics for dbx databases +.SH "SYNOPSIS" +.HP \w'\fBdbxstat\fR\ 'u +\fBdbxstat\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-indexdir\ \fR\fB\fIdirectory\fR\fR \fB\-idtype\ \fR\fB\fIlist\fR\fR \fB\-minimum\ \fR\fB\fIinteger\fR\fR \fB\-maximum\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBdbxstat\fR\ 'u +\fBdbxstat\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdbxstat\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database indexing" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-dbname\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-indexdir\fR \fIdirectory\fR +.RS 4 +Default value: \&. +.RE +.PP +\fB\-idtype\fR \fIlist\fR +.RS 4 +Default value: id +.RE +.SS "Required section" +.SS "Advanced section" +.PP +\fB\-minimum\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-maximum\fR \fIinteger\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +dbxstat is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/emowse.1e +++ emboss-6.1.0/debian/manpages/emowse.1e @@ -0,0 +1,106 @@ +'\" t +.\" Title: EMOWSE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "EMOWSE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +emowse \- Search protein sequences by digest fragment molecular weight +.SH "SYNOPSIS" +.HP \w'\fBemowse\fR\ 'u +\fBemowse\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-mwdata\ \fR\fB\fIdatafile\fR\fR \fB\-frequencies\ \fR\fB\fIdatafile\fR\fR \fB\-weight\ \fR\fB\fIinteger\fR\fR \fB\-mono\ \fR\fB\fIboolean\fR\fR \fB\-enzyme\ \fR\fB\fIlist\fR\fR \fB\-pcrange\ \fR\fB\fIinteger\fR\fR \fB\-tolerance\ \fR\fB\fIfloat\fR\fR \fB\-partials\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBemowse\fR\ 'u +\fBemowse\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBemowse\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.PP +\fB\-mwdata\fR \fIdatafile\fR +.RS 4 +Default value: Emolwt\&.dat +.RE +.PP +\fB\-frequencies\fR \fIdatafile\fR +.RS 4 +Default value: Efreqs\&.dat +.RE +.SS "Required section" +.PP +\fB\-weight\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-mono\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Advanced section" +.PP +\fB\-enzyme\fR \fIlist\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-pcrange\fR \fIinteger\fR +.RS 4 +Default value: 25 +.RE +.PP +\fB\-tolerance\fR \fIfloat\fR +.RS 4 +Default value: 0\&.1 +.RE +.PP +\fB\-partials\fR \fIfloat\fR +.RS 4 +Default value: 0\&.4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +emowse is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/cpgreport.1e +++ emboss-6.1.0/debian/manpages/cpgreport.1e @@ -0,0 +1,72 @@ +'\" t +.\" Title: CPGREPORT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CPGREPORT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +cpgreport \- Identify and report CpG\-rich regions in nucleotide sequence(s) +.SH "SYNOPSIS" +.HP \w'\fBcpgreport\fR\ 'u +\fBcpgreport\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-score\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR +.HP \w'\fBcpgreport\fR\ 'u +\fBcpgreport\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBcpgreport\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:CpG Islands" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-score\fR \fIinteger\fR +.RS 4 +This sets the score for each CG sequence found\&. A value of 17 is more sensitive, but 28 has also been used with some success\&. Default value: 17 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-outfeat\fR \fIfeatout\fR +.RS 4 +File for output features +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +cpgreport is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/showdb.1e +++ emboss-6.1.0/debian/manpages/showdb.1e @@ -0,0 +1,139 @@ +'\" t +.\" Title: SHOWDB +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SHOWDB" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +showdb \- Displays information on configured databases +.SH "SYNOPSIS" +.HP \w'\fBshowdb\fR\ 'u +\fBshowdb\fR [\fB\-database\ \fR\fB\fIstring\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR] [\fB\-protein\ \fR\fB\fIboolean\fR\fR] [\fB\-nucleic\ \fR\fB\fIboolean\fR\fR] [\fB\-full\ \fR\fB\fIboolean\fR\fR] [\fB\-methods\ \fR\fB\fIboolean\fR\fR] [\fB\-fields\ \fR\fB\fIboolean\fR\fR] [\fB\-defined\ \fR\fB\fIboolean\fR\fR] [\fB\-release\ \fR\fB\fIboolean\fR\fR] \fB\-only\ \fR\fB\fItoggle\fR\fR \fB\-heading\ \fR\fB\fIboolean\fR\fR \fB\-type\ \fR\fB\fIboolean\fR\fR \fB\-id\ \fR\fB\fIboolean\fR\fR \fB\-query\ \fR\fB\fIboolean\fR\fR \fB\-all\ \fR\fB\fIboolean\fR\fR \fB\-comment\ \fR\fB\fIboolean\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] +.HP \w'\fBshowdb\fR\ 'u +\fBshowdb\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBshowdb\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Information" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-database\fR \fIstring\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-html\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-protein\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-nucleic\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-full\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-methods\fR \fIboolean\fR +.RS 4 +This displays the access methods that can be used on this database, for all, query or ID access Default value: $(full) +.RE +.PP +\fB\-fields\fR \fIboolean\fR +.RS 4 +This displays the search fields that can be used on this database, other than the standard \'id\' or \'acc\' fields\&. Default value: $(full) +.RE +.PP +\fB\-defined\fR \fIboolean\fR +.RS 4 +This displays a short name for the file containing the database definition Default value: $(full) +.RE +.PP +\fB\-release\fR \fIboolean\fR +.RS 4 +Default value: $(full) +.RE +.SS "Advanced section" +.PP +\fB\-only\fR \fItoggle\fR +.RS 4 +This is a way of shortening the command line if you only want a few standard columns to be displayed\&. Instead of specifying: \'\-nohead \-notype \-noid \-noquery \-noall\' to get only the comment output, you can specify \'\-only \-comment\' Default value: N +.RE +.PP +\fB\-heading\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-type\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-id\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-query\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-all\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.PP +\fB\-comment\fR \fIboolean\fR +.RS 4 +Default value: @(!$(only)) +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +Default value: stdout +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +showdb is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/pepwindowall.1e +++ emboss-6.1.0/debian/manpages/pepwindowall.1e @@ -0,0 +1,78 @@ +'\" t +.\" Title: PEPWINDOWALL +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PEPWINDOWALL" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +pepwindowall \- Draw Kyte\-Doolittle hydropathy plot for a protein alignment +.SH "SYNOPSIS" +.HP \w'\fBpepwindowall\fR\ 'u +\fBpepwindowall\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR [\fB\-datafile\ \fR\fB\fIdatafile\fR\fR] [\fB\-length\ \fR\fB\fIinteger\fR\fR] [\fB\-normalize\ \fR\fB\fIboolean\fR\fR] \fB\-graph\ \fR\fB\fIxygraph\fR\fR +.HP \w'\fBpepwindowall\fR\ 'u +\fBpepwindowall\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBpepwindowall\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequences\fR \fIseqset\fR +.RS 4 +File containing a sequence alignment +.RE +.PP +\fB\-datafile\fR \fIdatafile\fR +.RS 4 +Default value: Enakai\&.dat +.RE +.SS "Additional section" +.PP +\fB\-length\fR \fIinteger\fR +.RS 4 +Default value: 19 +.RE +.PP +\fB\-normalize\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +pepwindowall is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/seealso.1e +++ emboss-6.1.0/debian/manpages/seealso.1e @@ -0,0 +1,101 @@ +'\" t +.\" Title: SEEALSO +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SEEALSO" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +seealso \- Finds programs with similar function to a specified program +.SH "SYNOPSIS" +.HP \w'\fBseealso\fR\ 'u +\fBseealso\fR \fB\-search\ \fR\fB\fIstring\fR\fR [\fB\-explode\ \fR\fB\fIboolean\fR\fR] \fB\-emboss\ \fR\fB\fIboolean\fR\fR \fB\-embassy\ \fR\fB\fIboolean\fR\fR \fB\-showembassy\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fItoggle\fR\fR] [\fB\-groups\ \fR\fB\fIboolean\fR\fR] \fB\-colon\ \fR\fB\fIboolean\fR\fR +.HP \w'\fBseealso\fR\ 'u +\fBseealso\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBseealso\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Information" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-search\fR \fIstring\fR +.RS 4 +Enter the name of an EMBOSS program +.RE +.SS "Additional section" +.PP +\fB\-explode\fR \fIboolean\fR +.RS 4 +The groups that EMBOSS applications belong to have two forms, exploded and not exploded\&. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones\&. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: \'NAME1\', \'NAME2\', \'NAME1 NAME2\', NAME2 NAME1\'\&. The non\-expanded names are simply like: \'NAME1 NAME2\'\&. Using expanded group names will find many more programs which share at least some of the expanded names than using the non\-exploded names and so you will get more programs reported as sharing a similar function than you will if you specify that you wish to use non\-exploded names Default value: N +.RE +.SS "Advanced section" +.PP +\fB\-emboss\fR \fIboolean\fR +.RS 4 +If you use this option then EMBOSS program documentation will be searched\&. If this option is set to be false, then only the EMBASSY programs will be searched (if the \-embassy option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y +.RE +.PP +\fB\-embassy\fR \fIboolean\fR +.RS 4 +If you use this option then EMBASSY program documentation will be searched\&. If this option is set to be false, then only the EMBOSS programs will be searched (if the \-emboss option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y +.RE +.PP +\fB\-showembassy\fR \fIstring\fR +.RS 4 +If you use this option then this EMBASSY package program documentation will be searched\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +Default value: stdout +.RE +.SS "Html section" +.PP +\fB\-html\fR \fItoggle\fR +.RS 4 +If you are sending the output to a file, this will format it for displaying as a table in a WWW document\&. Default value: N +.RE +.PP +\fB\-groups\fR \fIboolean\fR +.RS 4 +If you use this option, then only the group names will output to the file Default value: N +.RE +.PP +\fB\-colon\fR \fIboolean\fR +.RS 4 +The groups that EMBOSS applications belong to have up to two levels, for example the primary group \'ALIGNMENT\' has several sub\-groups, or second\-level groups, e\&.g\&.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE\&. To aid programs that parse the output of seealso that require the names of these subgroups, a colon \':\' will be placed between the first and second level of the group name if this option is true\&. Default value: N +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +seealso is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/dreg.1e +++ emboss-6.1.0/debian/manpages/dreg.1e @@ -0,0 +1,65 @@ +'\" t +.\" Title: DREG +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DREG" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +dreg \- Regular expression search of nucleotide sequence(s) +.SH "SYNOPSIS" +.HP \w'\fBdreg\fR\ 'u +\fBdreg\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-pattern\ \fR\fB\fIregexp\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBdreg\fR\ 'u +\fBdreg\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdreg\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Motifs" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-pattern\fR \fIregexp\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +dreg is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/isochore.1e +++ emboss-6.1.0/debian/manpages/isochore.1e @@ -0,0 +1,76 @@ +'\" t +.\" Title: ISOCHORE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ISOCHORE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +isochore \- Plots isochores in DNA sequences +.SH "SYNOPSIS" +.HP \w'\fBisochore\fR\ 'u +\fBisochore\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-window\ \fR\fB\fIinteger\fR\fR] [\fB\-shift\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR +.HP \w'\fBisochore\fR\ 'u +\fBisochore\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBisochore\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-window\fR \fIinteger\fR +.RS 4 +Default value: 1000 +.RE +.PP +\fB\-shift\fR \fIinteger\fR +.RS 4 +Default value: 100 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +isochore is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/codcmp.1e +++ emboss-6.1.0/debian/manpages/codcmp.1e @@ -0,0 +1,67 @@ +'\" t +.\" Title: CODCMP +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CODCMP" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +codcmp \- Codon usage table comparison +.SH "SYNOPSIS" +.HP \w'\fBcodcmp\fR\ 'u +\fBcodcmp\fR \fB\-first\ \fR\fB\fIcodon\fR\fR \fB\-second\ \fR\fB\fIcodon\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBcodcmp\fR\ 'u +\fBcodcmp\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBcodcmp\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Codon usage" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-first\fR \fIcodon\fR +.RS 4 +First codon usage file +.RE +.PP +\fB\-second\fR \fIcodon\fR +.RS 4 +Second codon usage file for comparison +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +codcmp is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/revseq.1e +++ emboss-6.1.0/debian/manpages/revseq.1e @@ -0,0 +1,72 @@ +'\" t +.\" Title: REVSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "REVSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +revseq \- Reverse and complement a nucleotide sequence +.SH "SYNOPSIS" +.HP \w'\fBrevseq\fR\ 'u +\fBrevseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-reverse\ \fR\fB\fIboolean\fR\fR \fB\-complement\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBrevseq\fR\ 'u +\fBrevseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBrevseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-reverse\fR \fIboolean\fR +.RS 4 +Set this to be false if you do not wish to reverse the output sequence Default value: Y +.RE +.PP +\fB\-complement\fR \fIboolean\fR +.RS 4 +Set this to be false if you do not wish to complement the output sequence Default value: Y +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +revseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/octanol.1e +++ emboss-6.1.0/debian/manpages/octanol.1e @@ -0,0 +1,87 @@ +'\" t +.\" Title: OCTANOL +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "OCTANOL" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +octanol \- Draw a White\-Wimley protein hydropathy plot +.SH "SYNOPSIS" +.HP \w'\fBoctanol\fR\ 'u +\fBoctanol\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-datafile\ \fR\fB\fIdatafile\fR\fR] [\fB\-width\ \fR\fB\fIinteger\fR\fR] \fB\-graph\ \fR\fB\fIxygraph\fR\fR [\fB\-plotoctanol\ \fR\fB\fIboolean\fR\fR] [\fB\-plotinterface\ \fR\fB\fIboolean\fR\fR] [\fB\-plotdifference\ \fR\fB\fIboolean\fR\fR] +.HP \w'\fBoctanol\fR\ 'u +\fBoctanol\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBoctanol\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fIdatafile\fR +.RS 4 +Default value: Ewhite\-wimley\&.dat +.RE +.SS "Additional section" +.PP +\fB\-width\fR \fIinteger\fR +.RS 4 +Default value: 19 +.RE +.SS "Output section" +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.PP +\fB\-plotoctanol\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-plotinterface\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-plotdifference\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +octanol is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/dbiflat.1e +++ emboss-6.1.0/debian/manpages/dbiflat.1e @@ -0,0 +1,121 @@ +'\" t +.\" Title: DBIFLAT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DBIFLAT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +dbiflat \- Index a flat file database +.SH "SYNOPSIS" +.HP \w'\fBdbiflat\fR\ 'u +\fBdbiflat\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-maxindex\ \fR\fB\fIinteger\fR\fR \fB\-sortoptions\ \fR\fB\fIstring\fR\fR \fB\-systemsort\ \fR\fB\fIboolean\fR\fR \fB\-cleanup\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR +.HP \w'\fBdbiflat\fR\ 'u +\fBdbiflat\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdbiflat\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database indexing" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-dbname\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-idformat\fR \fIlist\fR +.RS 4 +Default value: SWISS +.RE +.PP +\fB\-directory\fR \fIdirectory\fR +.RS 4 +Default value: \&. +.RE +.PP +\fB\-filenames\fR \fIstring\fR +.RS 4 +Default value: *\&.dat +.RE +.SS "Required section" +.PP +\fB\-release\fR \fIstring\fR +.RS 4 +Default value: 0\&.0 +.RE +.PP +\fB\-date\fR \fIstring\fR +.RS 4 +Default value: 00/00/00 +.RE +.SS "Advanced section" +.PP +\fB\-fields\fR \fIlist\fR +.RS 4 +Default value: acc +.RE +.PP +\fB\-exclude\fR \fIstring\fR +.RS 4 +.RE +.PP +\fB\-maxindex\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-sortoptions\fR \fIstring\fR +.RS 4 +Sort options, typically \'\-T \&.\' to use current directory for work files and \'\-k 1,1\' to force GNU sort to use the first field Default value: \-T \&. \-k 1,1 +.RE +.PP +\fB\-systemsort\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-cleanup\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.PP +\fB\-indexoutdir\fR \fIoutdir\fR +.RS 4 +Default value: \&. +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +dbiflat is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/sizeseq.1e +++ emboss-6.1.0/debian/manpages/sizeseq.1e @@ -0,0 +1,74 @@ +'\" t +.\" Title: SIZESEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SIZESEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +sizeseq \- Sort sequences by size +.SH "SYNOPSIS" +.HP \w'\fBsizeseq\fR\ 'u +\fBsizeseq\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR \fB\-descending\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBsizeseq\fR\ 'u +\fBsizeseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBsizeseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-feature\fR \fIboolean\fR +.RS 4 +Sequence feature information will be retained if this option is set\&. +.RE +.PP +\fB\-sequences\fR \fIseqset\fR +.RS 4 +.RE +.SS "Required section" +.PP +\fB\-descending\fR \fIboolean\fR +.RS 4 +By default the shortest sequence is given first\&. Default value: N +.RE +.SS "Additional section" +.SS "Advanced section" +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +sizeseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/lindna.1e +++ emboss-6.1.0/debian/manpages/lindna.1e @@ -0,0 +1,148 @@ +'\" t +.\" Title: LINDNA +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "LINDNA" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +lindna \- Draws linear maps of DNA constructs +.SH "SYNOPSIS" +.HP \w'\fBlindna\fR\ 'u +\fBlindna\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR [\fB\-maxgroups\ \fR\fB\fIinteger\fR\fR] [\fB\-maxlabels\ \fR\fB\fIinteger\fR\fR] \fB\-ruler\ \fR\fB\fIboolean\fR\fR \fB\-blocktype\ \fR\fB\fIlist\fR\fR [\fB\-intersymbol\ \fR\fB\fIselection\fR\fR] [\fB\-intercolour\ \fR\fB\fIinteger\fR\fR] [\fB\-interticks\ \fR\fB\fIboolean\fR\fR] [\fB\-gapsize\ \fR\fB\fIinteger\fR\fR] [\fB\-ticklines\ \fR\fB\fIboolean\fR\fR] [\fB\-textheight\ \fR\fB\fIfloat\fR\fR] [\fB\-textlength\ \fR\fB\fIfloat\fR\fR] [\fB\-margin\ \fR\fB\fIfloat\fR\fR] [\fB\-tickheight\ \fR\fB\fIfloat\fR\fR] [\fB\-blockheight\ \fR\fB\fIfloat\fR\fR] [\fB\-rangeheight\ \fR\fB\fIfloat\fR\fR] [\fB\-gapgroup\ \fR\fB\fIfloat\fR\fR] [\fB\-postext\ \fR\fB\fIfloat\fR\fR] \fB\-graphout\ \fR\fB\fIgraph\fR\fR +.HP \w'\fBlindna\fR\ 'u +\fBlindna\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBlindna\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +Default value: inputfile +.RE +.SS "Additional section" +.PP +\fB\-maxgroups\fR \fIinteger\fR +.RS 4 +Default value: 20 +.RE +.PP +\fB\-maxlabels\fR \fIinteger\fR +.RS 4 +Default value: 10000 +.RE +.SS "Output section" +.PP +\fB\-ruler\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.PP +\fB\-blocktype\fR \fIlist\fR +.RS 4 +Default value: Filled +.RE +.PP +\fB\-intersymbol\fR \fIselection\fR +.RS 4 +Default value: Straight +.RE +.PP +\fB\-intercolour\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-interticks\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-gapsize\fR \fIinteger\fR +.RS 4 +Default value: 500 +.RE +.PP +\fB\-ticklines\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-textheight\fR \fIfloat\fR +.RS 4 +Height of text\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-textlength\fR \fIfloat\fR +.RS 4 +Length of text\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-margin\fR \fIfloat\fR +.RS 4 +Width of left margin\&. This is the region left to the groups where the names of the groups are displayed\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-tickheight\fR \fIfloat\fR +.RS 4 +Height of ticks\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-blockheight\fR \fIfloat\fR +.RS 4 +Height of blocks\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1 +.RE +.PP +\fB\-rangeheight\fR \fIfloat\fR +.RS 4 +Height of range ends\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-gapgroup\fR \fIfloat\fR +.RS 4 +Space between groups\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-postext\fR \fIfloat\fR +.RS 4 +Space between text and ticks, blocks, and ranges\&. Enter a number <1\&.0 or >1\&.0 to decrease or increase the size, respectively Default value: 1\&.0 +.RE +.PP +\fB\-graphout\fR \fIgraph\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +lindna is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/degapseq.1e +++ emboss-6.1.0/debian/manpages/degapseq.1e @@ -0,0 +1,61 @@ +'\" t +.\" Title: DEGAPSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DEGAPSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +degapseq \- Removes non\-alphabetic (e\&.g\&. gap) characters from sequences +.SH "SYNOPSIS" +.HP \w'\fBdegapseq\fR\ 'u +\fBdegapseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBdegapseq\fR\ 'u +\fBdegapseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdegapseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +degapseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/consambig.1e +++ emboss-6.1.0/debian/manpages/consambig.1e @@ -0,0 +1,67 @@ +'\" t +.\" Title: CONSAMBIG +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CONSAMBIG" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +consambig \- Create an ambiguous consensus sequence from a multiple alignment +.SH "SYNOPSIS" +.HP \w'\fBconsambig\fR\ 'u +\fBconsambig\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR [\fB\-name\ \fR\fB\fIstring\fR\fR] +.HP \w'\fBconsambig\fR\ 'u +\fBconsambig\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBconsambig\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Consensus" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqset\fR +.RS 4 +File containing a sequence alignment\&. +.RE +.SS "Additional section" +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +.RE +.PP +\fB\-name\fR \fIstring\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +consambig is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/splitsource.1e +++ emboss-6.1.0/debian/manpages/splitsource.1e @@ -0,0 +1,68 @@ +'\" t +.\" Title: SPLITSOURCE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SPLITSOURCE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +splitsource \- Split sequence(s) into original source sequences +.SH "SYNOPSIS" +.HP \w'\fBsplitsource\fR\ 'u +\fBsplitsource\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBsplitsource\fR\ 'u +\fBsplitsource\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBsplitsource\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-feature\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Additional section" +.SS "Advanced section" +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +splitsource is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/rebaseextract.1e +++ emboss-6.1.0/debian/manpages/rebaseextract.1e @@ -0,0 +1,65 @@ +'\" t +.\" Title: REBASEEXTRACT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "REBASEEXTRACT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +rebaseextract \- Process the REBASE database for use by restriction enzyme applications +.SH "SYNOPSIS" +.HP \w'\fBrebaseextract\fR\ 'u +\fBrebaseextract\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-protofile\ \fR\fB\fIinfile\fR\fR [\fB\-equivalences\ \fR\fB\fIboolean\fR\fR] +.HP \w'\fBrebaseextract\fR\ 'u +\fBrebaseextract\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBrebaseextract\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database creation" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.PP +\fB\-protofile\fR \fIinfile\fR +.RS 4 +.RE +.PP +\fB\-equivalences\fR \fIboolean\fR +.RS 4 +This option calculates an embossre\&.equ file using restriction enzyme prototypes in the withrefm file\&. Default value: Y +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +rebaseextract is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/makenucseq.1e +++ emboss-6.1.0/debian/manpages/makenucseq.1e @@ -0,0 +1,88 @@ +'\" t +.\" Title: MAKENUCSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "MAKENUCSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +makenucseq \- Create random nucleotide sequences +.SH "SYNOPSIS" +.HP \w'\fBmakenucseq\fR\ 'u +\fBmakenucseq\fR \fB\-codonfile\ \fR\fB\fIcodon\fR\fR \fB\-amount\ \fR\fB\fIinteger\fR\fR \fB\-length\ \fR\fB\fIinteger\fR\fR [\fB\-useinsert\ \fR\fB\fItoggle\fR\fR] \fB\-insert\ \fR\fB\fIstring\fR\fR \fB\-start\ \fR\fB\fIinteger\fR\fR \fB\-makeseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBmakenucseq\fR\ 'u +\fBmakenucseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBmakenucseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-codonfile\fR \fIcodon\fR +.RS 4 +Optional codon usage file\&. Nucleotide sequences will be created as triplets matching the frequencies in the file, with the end trimmed to be in the correct reading frame\&. +.RE +.SS "Required section" +.PP +\fB\-amount\fR \fIinteger\fR +.RS 4 +Default value: 100 +.RE +.PP +\fB\-length\fR \fIinteger\fR +.RS 4 +Default value: 100 +.RE +.PP +\fB\-useinsert\fR \fItoggle\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-insert\fR \fIstring\fR +.RS 4 +String that is inserted into sequence +.RE +.PP +\fB\-start\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.SS "Output section" +.PP +\fB\-makeseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +makenucseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/showseq.1e +++ emboss-6.1.0/debian/manpages/showseq.1e @@ -0,0 +1,264 @@ +'\" t +.\" Title: SHOWSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "SHOWSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +showseq \- Displays sequences with features in pretty format +.SH "SYNOPSIS" +.HP \w'\fBshowseq\fR\ 'u +\fBshowseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-mfile\ \fR\fB\fIdatafile\fR\fR \fB\-format\ \fR\fB\fIlist\fR\fR \fB\-things\ \fR\fB\fIlist\fR\fR [\fB\-translate\ \fR\fB\fIrange\fR\fR] [\fB\-revtranslate\ \fR\fB\fIrange\fR\fR] [\fB\-uppercase\ \fR\fB\fIrange\fR\fR] [\fB\-highlight\ \fR\fB\fIrange\fR\fR] [\fB\-annotation\ \fR\fB\fIrange\fR\fR] [\fB\-enzymes\ \fR\fB\fIstring\fR\fR] [\fB\-table\ \fR\fB\fIlist\fR\fR] [\fB\-sourcematch\ \fR\fB\fIstring\fR\fR] [\fB\-typematch\ \fR\fB\fIstring\fR\fR] [\fB\-sensematch\ \fR\fB\fIinteger\fR\fR] [\fB\-minscore\ \fR\fB\fIfloat\fR\fR] [\fB\-maxscore\ \fR\fB\fIfloat\fR\fR] [\fB\-tagmatch\ \fR\fB\fIstring\fR\fR] [\fB\-valuematch\ \fR\fB\fIstring\fR\fR] [\fB\-stricttags\ \fR\fB\fIboolean\fR\fR] \fB\-flatreformat\ \fR\fB\fIboolean\fR\fR \fB\-mincuts\ \fR\fB\fIinteger\fR\fR \fB\-maxcuts\ \fR\fB\fIinteger\fR\fR \fB\-sitelen\ \fR\fB\fIinteger\fR\fR \fB\-single\ \fR\fB\fIboolean\fR\fR \fB\-blunt\ \fR\fB\fIboolean\fR\fR \fB\-sticky\ \fR\fB\fIboolean\fR\fR \fB\-ambiguity\ \fR\fB\fIboolean\fR\fR \fB\-plasmid\ \fR\fB\fIboolean\fR\fR \fB\-methylation\ \fR\fB\fIboolean\fR\fR \fB\-commercial\ \fR\fB\fIboolean\fR\fR \fB\-limit\ \fR\fB\fIboolean\fR\fR \fB\-orfminsize\ \fR\fB\fIinteger\fR\fR \fB\-threeletter\ \fR\fB\fIboolean\fR\fR \fB\-number\ \fR\fB\fIboolean\fR\fR \fB\-width\ \fR\fB\fIinteger\fR\fR \fB\-length\ \fR\fB\fIinteger\fR\fR \fB\-margin\ \fR\fB\fIinteger\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR \fB\-offset\ \fR\fB\fIinteger\fR\fR \fB\-html\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBshowseq\fR\ 'u +\fBshowseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBshowseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Nucleic:Translation,Nucleic:Restriction" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-mfile\fR \fIdatafile\fR +.RS 4 +Default value: Emethylsites\&.dat +.RE +.SS "Required section" +.PP +\fB\-format\fR \fIlist\fR +.RS 4 +Default value: 2 +.RE +.PP +\fB\-things\fR \fIlist\fR +.RS 4 +Specify a list of one or more code characters in the order in which you wish things to be displayed one above the other down the page\&. For example if you wish to see things displayed in the order: sequence, complement sequence, ticks line, frame 1 translation, blank line; then you should enter \'S,C,T,1,B\'\&. Default value: B,N,T,S,A,F +.RE +.SS "Additional section" +.PP +\fB\-translate\fR \fIrange\fR +.RS 4 +Regions to translate (if translating)\&. If this is left blank the complete sequence is translated\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are separated by any non\-digit, non\-alpha character\&. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765\&.\&.888 +.RE +.PP +\fB\-revtranslate\fR \fIrange\fR +.RS 4 +Regions to translate (if translating)\&. If this is left blank the complete sequence is translated\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are separated by any non\-digit, non\-alpha character\&. Examples of region specifications are: 78\-56, 45\-24, 888\&.\&.765, 99=67; 45:1 +.RE +.PP +\fB\-uppercase\fR \fIrange\fR +.RS 4 +Regions to put in uppercase\&. If this is left blank, then the sequence case is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are separated by any non\-digit, non\-alpha character\&. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765\&.\&.888 1,5,8,10,23,45,57,99 +.RE +.PP +\fB\-highlight\fR \fIrange\fR +.RS 4 +Regions to colour if formatting for HTML\&. If this is left blank, then the sequence is left alone\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are followed by any valid HTML font colour\&. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as \'@filename\'\&. +.RE +.PP +\fB\-annotation\fR \fIrange\fR +.RS 4 +Regions to annotate by marking\&. If this is left blank, then no annotation is added\&. A set of regions is specified by a set of pairs of positions followed by optional text\&. The positions are integers\&. They are followed by any text (but not digits when on the command\-line)\&. Examples of region specifications are: 24\-45 new domain 56\-78 match to Mouse 1\-100 First part 120\-156 oligo A file of ranges to annotate (one range per line) can be specified as \'@filename\'\&. +.RE +.PP +\fB\-enzymes\fR \fIstring\fR +.RS 4 +The name \'all\' reads in all enzyme names from the REBASE database\&. You can specify enzymes by giving their names with commas between then, such as: \'HincII,hinfI,ppiI,hindiii\'\&. The case of the names is not important\&. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a \'@\' character in front of it, for example, \'@enz\&.list\'\&. Blank lines and lines starting with a hash character or \'!\' are ignored and all other lines are concatenated together with a comma character \',\' and then treated as the list of enzymes to search for\&. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Default value: all +.RE +.PP +\fB\-table\fR \fIlist\fR +.RS 4 +.RE +.SS "Feature display options" +.PP +\fB\-sourcematch\fR \fIstring\fR +.RS 4 +By default any feature source in the feature table is shown\&. You can set this to match any feature source you wish to show\&. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from\&. The source may be wildcarded by using \'*\'\&. If you wish to show more than one source, separate their names with the character \'|\', eg: gene* | embl Default value: * +.RE +.PP +\fB\-typematch\fR \fIstring\fR +.RS 4 +By default any feature type in the feature table is shown\&. You can set this to match any feature type you wish to show\&. See http://www3\&.ebi\&.ac\&.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www\&.expasy\&.ch/txt/userman\&.txt for a list of the Swissprot feature types\&. The type may be wildcarded by using \'*\'\&. If you wish to show more than one type, separate their names with the character \'|\', eg: *UTR | intron Default value: * +.RE +.PP +\fB\-sensematch\fR \fIinteger\fR +.RS 4 +By default any feature type in the feature table is shown\&. You can set this to match any feature sense you wish to show\&. 0 \- any sense, 1 \- forward sense, \-1 \- reverse sense +.RE +.PP +\fB\-minscore\fR \fIfloat\fR +.RS 4 +Minimum score of feature to display (see also maxscore) Default value: 0\&.0 +.RE +.PP +\fB\-maxscore\fR \fIfloat\fR +.RS 4 +Maximum score of feature to display\&. If both minscore and maxscore are zero (the default), then any score is ignored Default value: 0\&.0 +.RE +.PP +\fB\-tagmatch\fR \fIstring\fR +.RS 4 +Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Some of these tags also have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag in the feature table is shown\&. You can set this to match any feature tag you wish to show\&. The tag may be wildcarded by using \'*\'\&. If you wish to show more than one tag, separate their names with the character \'|\', eg: gene | label Default value: * +.RE +.PP +\fB\-valuematch\fR \fIstring\fR +.RS 4 +Tag values are the values associated with a feature tag\&. Tags are the types of extra values that a feature may have\&. For example in the EMBL feature table, a \'CDS\' type of feature may have the tags \'/codon\', \'/codon_start\', \'/db_xref\', \'/EC_number\', \'/evidence\', \'/exception\', \'/function\', \'/gene\', \'/label\', \'/map\', \'/note\', \'/number\', \'/partial\', \'/product\', \'/protein_id\', \'/pseudo\', \'/standard_name\', \'/translation\', \'/transl_except\', \'/transl_table\', or \'/usedin\'\&. Only some of these tags can have values, for example \'/gene\' can have the value of the gene name\&. By default any feature tag value in the feature table is shown\&. You can set this to match any feature tag valueyou wish to show\&. The tag value may be wildcarded by using \'*\'\&. If you wish to show more than one tag value, separate their names with the character \'|\', eg: pax* | 10 Default value: * +.RE +.PP +\fB\-stricttags\fR \fIboolean\fR +.RS 4 +By default if any tag/value pair in a feature matches the specified tag and value, then all the tags/value pairs of that feature will be displayed\&. If this is set to be true, then only those tag/value pairs in a feature that match the specified tag and value will be displayed\&. Default value: N +.RE +.SS "Advanced section" +.SS "Restriction map options" +.PP +\fB\-flatreformat\fR \fIboolean\fR +.RS 4 +This changes the output format to one where the recognition site is indicated by a row of \'===\' characters and the cut site is pointed to by a \'>\' character in the forward sense, or a \'<\' in the reverse sense strand\&. Default value: N +.RE +.PP +\fB\-mincuts\fR \fIinteger\fR +.RS 4 +This sets the minimum number of cuts for any restriction enzyme that will be considered\&. Any enzymes that cut fewer times than this will be ignored\&. Default value: 1 +.RE +.PP +\fB\-maxcuts\fR \fIinteger\fR +.RS 4 +This sets the maximum number of cuts for any restriction enzyme that will be considered\&. Any enzymes that cut more times than this will be ignored\&. Default value: 2000000000 +.RE +.PP +\fB\-sitelen\fR \fIinteger\fR +.RS 4 +This sets the minimum length of the restriction enzyme recognition site\&. Any enzymes with sites shorter than this will be ignored\&. Default value: 4 +.RE +.PP +\fB\-single\fR \fIboolean\fR +.RS 4 +If this is set then this forces the values of the mincuts and maxcuts qualifiers to both be 1\&. Any other value you may have set them to will be ignored\&. Default value: N +.RE +.PP +\fB\-blunt\fR \fIboolean\fR +.RS 4 +This allows those enzymes which cut at the same position on the forward and reverse strands to be considered\&. Default value: Y +.RE +.PP +\fB\-sticky\fR \fIboolean\fR +.RS 4 +This allows those enzymes which cut at different positions on the forward and reverse strands, leaving an overhang, to be considered\&. Default value: Y +.RE +.PP +\fB\-ambiguity\fR \fIboolean\fR +.RS 4 +This allows those enzymes which have one or more \'N\' ambiguity codes in their pattern to be considered Default value: Y +.RE +.PP +\fB\-plasmid\fR \fIboolean\fR +.RS 4 +If this is set then this allows searches for restriction enzyme recognition site and cut postions that span the end of the sequence to be considered\&. Default value: N +.RE +.PP +\fB\-methylation\fR \fIboolean\fR +.RS 4 +If this is set then RE recognition sites will not match methylated bases\&. Default value: N +.RE +.PP +\fB\-commercial\fR \fIboolean\fR +.RS 4 +If this is set, then only those enzymes with a commercial supplier will be searched for\&. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through \'all\' the enzymes in the REBASE database\&. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier\&. Default value: Y +.RE +.PP +\fB\-limit\fR \fIboolean\fR +.RS 4 +This limits the reporting of enzymes to just one enzyme from each group of isoschizomers\&. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file \'embossre\&.equ\', which is created by the program \'rebaseextract\'\&. If you prefer different prototypes to be used, make a copy of embossre\&.equ in your home directory and edit it\&. If this value is set to be false then all of the input enzymes will be reported\&. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching \'all\' of them\&. Default value: Y +.RE +.PP +\fB\-orfminsize\fR \fIinteger\fR +.RS 4 +This sets the minimum size of Open Reading Frames (ORFs) to display in the translations\&. All other translation regions are masked by changing the amino acids to \'\-\' characters\&. +.RE +.PP +\fB\-threeletter\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-number\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-width\fR \fIinteger\fR +.RS 4 +Default value: 60 +.RE +.PP +\fB\-length\fR \fIinteger\fR +.RS 4 +.RE +.PP +\fB\-margin\fR \fIinteger\fR +.RS 4 +Default value: 10 +.RE +.PP +\fB\-name\fR \fIboolean\fR +.RS 4 +Set this to be false if you do not wish to display the ID name of the sequence Default value: Y +.RE +.PP +\fB\-description\fR \fIboolean\fR +.RS 4 +Set this to be false if you do not wish to display the description of the sequence Default value: Y +.RE +.PP +\fB\-offset\fR \fIinteger\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-html\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +showseq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/transeq.1e +++ emboss-6.1.0/debian/manpages/transeq.1e @@ -0,0 +1,92 @@ +'\" t +.\" Title: TRANSEQ +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "TRANSEQ" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +transeq \- Translate nucleic acid sequences +.SH "SYNOPSIS" +.HP \w'\fBtranseq\fR\ 'u +\fBtranseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-frame\ \fR\fB\fIlist\fR\fR] [\fB\-table\ \fR\fB\fIlist\fR\fR] [\fB\-regions\ \fR\fB\fIrange\fR\fR] [\fB\-trim\ \fR\fB\fIboolean\fR\fR] [\fB\-clean\ \fR\fB\fIboolean\fR\fR] \fB\-alternative\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBtranseq\fR\ 'u +\fBtranseq\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBtranseq\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Translation" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Additional section" +.PP +\fB\-frame\fR \fIlist\fR +.RS 4 +Default value: 1 +.RE +.PP +\fB\-table\fR \fIlist\fR +.RS 4 +.RE +.PP +\fB\-regions\fR \fIrange\fR +.RS 4 +Regions to translate\&. If this is left blank, then the complete sequence is translated\&. A set of regions is specified by a set of pairs of positions\&. The positions are integers\&. They are separated by any non\-digit, non\-alpha character\&. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765\&.\&.888 1,5,8,10,23,45,57,99 Note: you should not try to use this option with any other frame than the default, \-frame=1 +.RE +.PP +\fB\-trim\fR \fIboolean\fR +.RS 4 +This removes all \'X\' and \'*\' characters from the right end of the translation\&. The trimming process starts at the end and continues until the next character is not a \'X\' or a \'*\' Default value: N +.RE +.PP +\fB\-clean\fR \fIboolean\fR +.RS 4 +This changes all STOP codon positions from the \'*\' character to \'X\' (an unknown residue)\&. This is useful because some programs will not accept protein sequences with \'*\' characters in them\&. Default value: N +.RE +.SS "Advanced section" +.PP +\fB\-alternative\fR \fIboolean\fR +.RS 4 +The default definition of frame \'\-1\' is the reverse\-complement of the set of codons used in frame 1\&. (Frame \-2 is the set of codons used by frame 2, similarly frames \-3 and 3)\&. This is a common standard, used by the Staden package and other programs\&. If you prefer to define frame \'\-1\' as using the set of codons starting with the last codon of the sequence, then set this to be true\&. Default value: N +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqoutall\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +transeq is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/fuzznuc.1e +++ emboss-6.1.0/debian/manpages/fuzznuc.1e @@ -0,0 +1,72 @@ +'\" t +.\" Title: FUZZNUC +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "FUZZNUC" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +fuzznuc \- Search for patterns in nucleotide sequences +.SH "SYNOPSIS" +.HP \w'\fBfuzznuc\fR\ 'u +\fBfuzznuc\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-pattern\ \fR\fB\fIpattern\fR\fR \fB\-complement\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR +.HP \w'\fBfuzznuc\fR\ 'u +\fBfuzznuc\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBfuzznuc\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Motifs" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-pattern\fR \fIpattern\fR +.RS 4 +The standard IUPAC one\-letter codes for the nucleotides are used\&. The symbol \'n\' is used for a position where any nucleotide is accepted\&. Ambiguities are indicated by listing the acceptable nucleotides for a given position, between square parentheses \'[ ]\'\&. For example: [ACG] stands for A or C or G\&. Ambiguities are also indicated by listing between a pair of curly brackets \'{ }\' the nucleotides that are not accepted at a given position\&. For example: {AG} stands for any nucleotides except A and G\&. Each element in a pattern is separated from its neighbor by a \'\-\'\&. (Optional in fuzznuc)\&. Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis\&. Examples: N(3) corresponds to N\-N\-N, N(2,4) corresponds to N\-N or N\-N\-N or N\-N\-N\-N\&. When a pattern is restricted to either the 5\' or 3\' end of a sequence, that pattern either starts with a \'<\' symbol or respectively ends with a \'>\' symbol\&. A period ends the pattern\&. (Optional in fuzznuc)\&. For example, [CG](5)TG{A}N(1,5)C +.RE +.SS "Advanced section" +.PP +\fB\-complement\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIreport\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +fuzznuc is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/prima.1e +++ emboss-6.1.0/debian/manpages/prima.1e @@ -0,0 +1,157 @@ +'\" t +.\" Title: PRIMA +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "PRIMA" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +prima \- Selects primers for PCR and DNA amplification\&. +.SH "SYNOPSIS" +.HP \w'\fBprima\fR\ 'u +\fBprima\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-targetrange\ \fR\fB\fItoggle\fR\fR \fB\-targetstart\ \fR\fB\fIinteger\fR\fR \fB\-targetend\ \fR\fB\fIinteger\fR\fR \fB\-mintmprimer\ \fR\fB\fIfloat\fR\fR \fB\-maxtmprimer\ \fR\fB\fIfloat\fR\fR \fB\-minplen\ \fR\fB\fIinteger\fR\fR \fB\-maxplen\ \fR\fB\fIinteger\fR\fR \fB\-minpgccont\ \fR\fB\fIfloat\fR\fR \fB\-maxpgccont\ \fR\fB\fIfloat\fR\fR [\fB\-primer\ \fR\fB\fItoggle\fR\fR] \fB\-minprimerlen\ \fR\fB\fIinteger\fR\fR \fB\-maxprimerlen\ \fR\fB\fIinteger\fR\fR \fB\-minpmgccont\ \fR\fB\fIfloat\fR\fR \fB\-maxpmgccont\ \fR\fB\fIfloat\fR\fR \fB\-overlap\ \fR\fB\fIinteger\fR\fR \fB\-saltconc\ \fR\fB\fIfloat\fR\fR \fB\-dnaconc\ \fR\fB\fIfloat\fR\fR \fB\-list\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBprima\fR\ 'u +\fBprima\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBprima\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Primers" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIsequence\fR +.RS 4 +.RE +.SS "Required section" +.SS "Target options" +.PP +\fB\-targetrange\fR \fItoggle\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-targetstart\fR \fIinteger\fR +.RS 4 +Default value: $(sequence\&.begin) +.RE +.PP +\fB\-targetend\fR \fIinteger\fR +.RS 4 +Default value: $(sequence\&.length) +.RE +.PP +\fB\-mintmprimer\fR \fIfloat\fR +.RS 4 +Default value: 53 +.RE +.PP +\fB\-maxtmprimer\fR \fIfloat\fR +.RS 4 +Default value: 58 +.RE +.SS "Additional section" +.SS "Product options" +.PP +\fB\-minplen\fR \fIinteger\fR +.RS 4 +Default value: 100 +.RE +.PP +\fB\-maxplen\fR \fIinteger\fR +.RS 4 +Default value: 300 +.RE +.PP +\fB\-minpgccont\fR \fIfloat\fR +.RS 4 +Default value: \&.40 +.RE +.PP +\fB\-maxpgccont\fR \fIfloat\fR +.RS 4 +Default value: \&.55 +.RE +.SS "Primer options" +.PP +\fB\-primer\fR \fItoggle\fR +.RS 4 +Specify primer properties Default value: Y +.RE +.PP +\fB\-minprimerlen\fR \fIinteger\fR +.RS 4 +Default value: 18 +.RE +.PP +\fB\-maxprimerlen\fR \fIinteger\fR +.RS 4 +Default value: 22 +.RE +.PP +\fB\-minpmgccont\fR \fIfloat\fR +.RS 4 +Default value: \&.40 +.RE +.PP +\fB\-maxpmgccont\fR \fIfloat\fR +.RS 4 +Default value: \&.55 +.RE +.SS "Advanced section" +.PP +\fB\-overlap\fR \fIinteger\fR +.RS 4 +Default value: 50 +.RE +.PP +\fB\-saltconc\fR \fIfloat\fR +.RS 4 +Default value: 50 +.RE +.PP +\fB\-dnaconc\fR \fIfloat\fR +.RS 4 +Default value: 50 +.RE +.PP +\fB\-list\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +prima is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/stretcher.1e +++ emboss-6.1.0/debian/manpages/stretcher.1e @@ -0,0 +1,81 @@ +'\" t +.\" Title: STRETCHER +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "STRETCHER" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +stretcher \- Needleman\-Wunsch rapid global alignment of two sequences +.SH "SYNOPSIS" +.HP \w'\fBstretcher\fR\ 'u +\fBstretcher\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR [\fB\-datafile\ \fR\fB\fImatrix\fR\fR] [\fB\-gapopen\ \fR\fB\fIinteger\fR\fR] [\fB\-gapextend\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR +.HP \w'\fBstretcher\fR\ 'u +\fBstretcher\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBstretcher\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Global" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-asequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-bsequence\fR \fIsequence\fR +.RS 4 +.RE +.PP +\fB\-datafile\fR \fImatrix\fR +.RS 4 +This is the scoring matrix file used when comparing sequences\&. By default it is the file \'EBLOSUM62\' (for proteins) or the file \'EDNAFULL\' (for nucleic sequences)\&. These files are found in the \'data\' directory of the EMBOSS installation\&. +.RE +.SS "Additional section" +.PP +\fB\-gapopen\fR \fIinteger\fR +.RS 4 +Default value: @($(acdprotein)? 12 : 16) +.RE +.PP +\fB\-gapextend\fR \fIinteger\fR +.RS 4 +Default value: @($(acdprotein)? 2 : 4) +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIalign\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +stretcher is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/charge.1e +++ emboss-6.1.0/debian/manpages/charge.1e @@ -0,0 +1,81 @@ +'\" t +.\" Title: CHARGE +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CHARGE" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +charge \- Draw a protein charge plot +.SH "SYNOPSIS" +.HP \w'\fBcharge\fR\ 'u +\fBcharge\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-aadata\ \fR\fB\fIdatafile\fR\fR [\fB\-window\ \fR\fB\fIinteger\fR\fR] \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBcharge\fR\ 'u +\fBcharge\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBcharge\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-seqall\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-aadata\fR \fIdatafile\fR +.RS 4 +Default value: Eamino\&.dat +.RE +.SS "Additional section" +.PP +\fB\-window\fR \fIinteger\fR +.RS 4 +Default value: 5 +.RE +.SS "Output section" +.PP +\fB\-plot\fR \fItoggle\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-graph\fR \fIxygraph\fR +.RS 4 +.RE +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +charge is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/chips.1e +++ emboss-6.1.0/debian/manpages/chips.1e @@ -0,0 +1,67 @@ +'\" t +.\" Title: CHIPS +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "CHIPS" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +chips \- Calculates Nc codon usage statistic +.SH "SYNOPSIS" +.HP \w'\fBchips\fR\ 'u +\fBchips\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-sum\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBchips\fR\ 'u +\fBchips\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBchips\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Codon usage" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-seqall\fR \fIseqall\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-sum\fR \fIboolean\fR +.RS 4 +Default value: Y +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +chips is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/nohtml.1e +++ emboss-6.1.0/debian/manpages/nohtml.1e @@ -0,0 +1,64 @@ +'\" t +.\" Title: NOHTML +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "NOHTML" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +nohtml \- Remove mark\-up (e\&.g\&. HTML tags) from an ASCII text file +.SH "SYNOPSIS" +.HP \w'\fBnohtml\fR\ 'u +\fBnohtml\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBnohtml\fR\ 'u +\fBnohtml\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBnohtml\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-infile\fR \fIinfile\fR +.RS 4 +.RE +.SS "Required section" +.SS "Additional section" +.SS "Advanced section" +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +nohtml is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/acdlog.1e +++ emboss-6.1.0/debian/manpages/acdlog.1e @@ -0,0 +1,51 @@ +'\" t +.\" Title: ACDLOG +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "ACDLOG" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +acdlog \- Test application ACD file processing and trace data structures +.SH "SYNOPSIS" +.HP \w'\fBacdlog\fR\ 'u +\fBacdlog\fR +.HP \w'\fBacdlog\fR\ 'u +\fBacdlog\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBacdlog\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd" command group(s)\&. +.SH "OPTIONS" +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +acdlog is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/union.1e +++ emboss-6.1.0/debian/manpages/union.1e @@ -0,0 +1,81 @@ +'\" t +.\" Title: UNION +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "UNION" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +union \- Concatenate multiple sequences into a single sequence +.SH "SYNOPSIS" +.HP \w'\fBunion\fR\ 'u +\fBunion\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-source\ \fR\fB\fIboolean\fR\fR \fB\-findoverlap\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR [\fB\-overlapfile\ \fR\fB\fIoutfile\fR\fR] +.HP \w'\fBunion\fR\ 'u +\fBunion\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBunion\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-feature\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.SS "Advanced section" +.PP +\fB\-source\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.PP +\fB\-findoverlap\fR \fIboolean\fR +.RS 4 +Default value: N +.RE +.SS "Output section" +.PP +\fB\-outseq\fR \fIseqout\fR +.RS 4 +.RE +.PP +\fB\-overlapfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +union is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/distmat.1e +++ emboss-6.1.0/debian/manpages/distmat.1e @@ -0,0 +1,99 @@ +'\" t +.\" Title: DISTMAT +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "DISTMAT" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +distmat \- Create a distance matrix from a multiple sequence alignment +.SH "SYNOPSIS" +.HP \w'\fBdistmat\fR\ 'u +\fBdistmat\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR \fB\-nucmethod\ \fR\fB\fIlist\fR\fR \fB\-protmethod\ \fR\fB\fIlist\fR\fR \fB\-ambiguous\ \fR\fB\fIboolean\fR\fR \fB\-gapweight\ \fR\fB\fIfloat\fR\fR \fB\-position\ \fR\fB\fIinteger\fR\fR \fB\-calculatea\ \fR\fB\fIboolean\fR\fR \fB\-parametera\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR +.HP \w'\fBdistmat\fR\ 'u +\fBdistmat\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBdistmat\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Phylogeny:Molecular sequence" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqset\fR +.RS 4 +File containing a sequence alignment\&. +.RE +.SS "Required section" +.PP +\fB\-nucmethod\fR \fIlist\fR +.RS 4 +Multiple substitution correction methods for nucleotides\&. +.RE +.PP +\fB\-protmethod\fR \fIlist\fR +.RS 4 +Multiple substitution correction methods for proteins\&. +.RE +.SS "Additional section" +.PP +\fB\-ambiguous\fR \fIboolean\fR +.RS 4 +Option to use the ambiguous codes in the calculation of the Jukes\-Cantor method or if the sequences are proteins\&. Default value: N +.RE +.PP +\fB\-gapweight\fR \fIfloat\fR +.RS 4 +Option to weight gaps in the uncorrected (nucleotide) and Jukes\-Cantor distance methods\&. Default value: 0\&. +.RE +.PP +\fB\-position\fR \fIinteger\fR +.RS 4 +Choose base positions to analyse in each codon i\&.e\&. 123 (all bases), 12 (the first two bases), 1, 2, or 3 individual bases\&. Default value: 123 +.RE +.PP +\fB\-calculatea\fR \fIboolean\fR +.RS 4 +This will force the calculation of parameter \'a\' in the Jin\-Nei Gamma distance calculation, otherwise the default is 1\&.0 (see \-parametera option)\&. Default value: N +.RE +.PP +\fB\-parametera\fR \fIfloat\fR +.RS 4 +User defined parameter \'a\' to be use in the Jin\-Nei Gamma distance calculation\&. The suggested value to be used is 1\&.0 (Jin et al\&.) and this is the default\&. Default value: 1\&.0 +.RE +.SS "Output section" +.PP +\fB\-outfile\fR \fIoutfile\fR +.RS 4 +.RE +.SH "BUGS" +.PP +Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&. +.SH "SEE ALSO" +.PP +distmat is fully documented via the +\fBtfm\fR(1) +system\&. +.SH "AUTHOR" +.PP +\fBDebian\-Med Packaging Team\fR <\&debian\-med\-packaging@lists\&.alioth\&.debian\&.org\&> +.RS 4 +Wrote the script used to autogenerate this manual page\&. +.RE +.SH "COPYRIGHT" +.br +.PP +This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&. +.sp --- emboss-6.1.0.orig/debian/manpages/msbar.1e +++ emboss-6.1.0/debian/manpages/msbar.1e @@ -0,0 +1,102 @@ +'\" t +.\" Title: MSBAR +.\" Author: Debian-Med Packaging Team +.\" Generator: DocBook XSL Stylesheets v1.75.1 +.\" Date: 07/15/2009 +.\" Manual: EMBOSS Manual for Debian +.\" Source: EMBOSS 6.1.0 +.\" Language: English +.\" +.TH "MSBAR" "1e" "07/15/2009" "EMBOSS 6.1.0" "EMBOSS Manual for Debian" +.\" ----------------------------------------------------------------- +.\" * set default formatting +.\" ----------------------------------------------------------------- +.\" disable hyphenation +.nh +.\" disable justification (adjust text to left margin only) +.ad l +.\" ----------------------------------------------------------------- +.\" * MAIN CONTENT STARTS HERE * +.\" ----------------------------------------------------------------- +.SH "NAME" +msbar \- Mutate a sequence +.SH "SYNOPSIS" +.HP \w'\fBmsbar\fR\ 'u +\fBmsbar\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-othersequence\ \fR\fB\fIseqall\fR\fR \fB\-count\ \fR\fB\fIinteger\fR\fR \fB\-point\ \fR\fB\fIlist\fR\fR \fB\-block\ \fR\fB\fIlist\fR\fR \fB\-codon\ \fR\fB\fIlist\fR\fR \fB\-inframe\ \fR\fB\fIboolean\fR\fR \fB\-minimum\ \fR\fB\fIinteger\fR\fR \fB\-maximum\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR +.HP \w'\fBmsbar\fR\ 'u +\fBmsbar\fR \fB\-help\fR +.SH "DESCRIPTION" +.PP +\fBmsbar\fR +is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Mutation,Protein:Mutation" command group(s)\&. +.SH "OPTIONS" +.SS "Input section" +.PP +\fB\-sequence\fR \fIseqall\fR +.RS 4 +.RE +.PP +\fB\-othersequence\fR \fIseqall\fR +.RS 4 +If you require that the resulting mutated sequence should not match a set of other sequences, then you can specify that set of sequences here\&. For example, if you require that the mutated sequence should not be the same as the input sequence, enter the input sequence here\&. If you want the result to be different to previous results of this program, specify the previous result sequences here\&. The program will check that the result does not match the sequences specified here before writing